ID: 1004211103

View in Genome Browser
Species Human (GRCh38)
Location 6:13645328-13645350
Sequence CTCAAATATATGTATTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004211100_1004211103 22 Left 1004211100 6:13645283-13645305 CCAGGAAGAGTGGAGATTCTCTA 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG 0: 1
1: 0
2: 7
3: 42
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004211103 Original CRISPR CTCAAATATATGTATTTCAA GGG Intronic
900697541 1:4021558-4021580 CTCAGGAAAATGTATTTCAAGGG + Intergenic
902350986 1:15854269-15854291 GGCTAATATATGTGTTTCAAGGG - Intronic
903584401 1:24400030-24400052 CACATATTTATGTATTTCATGGG - Intronic
904797572 1:33068838-33068860 CACAAATATATATATTTGAATGG + Intronic
905619288 1:39428460-39428482 GTTAAATATAAGTATTTCCATGG - Intronic
906277668 1:44529259-44529281 TTCAAATATATGTTTTTAAATGG - Intronic
908297984 1:62732117-62732139 CTCACTTATATTTCTTTCAATGG + Intergenic
908720518 1:67120491-67120513 CTTCAATATATGAATTTGAAGGG - Intronic
908865242 1:68541416-68541438 TTTATATATATGTATTTAAAGGG + Intergenic
909003501 1:70247717-70247739 TTAAAACATTTGTATTTCAAAGG + Intronic
909068016 1:70959860-70959882 CTTCAATATATGAATTTGAAAGG - Intronic
909142570 1:71887324-71887346 TTCAAATTTATGTTGTTCAAGGG + Intronic
910028312 1:82685343-82685365 TTCAAATCTTTGTTTTTCAAAGG - Intergenic
910131580 1:83914044-83914066 CTAAAATATATTTCTTCCAAAGG + Intronic
910837150 1:91526231-91526253 CTAAAATATTTGAATTTCTAAGG + Intergenic
910899807 1:92107695-92107717 TGGAAATATATATATTTCAAAGG + Intronic
911542574 1:99175826-99175848 CTTTAATATATGAATTTCATGGG + Intergenic
911830171 1:102540377-102540399 CTCAATTATATTACTTTCAAAGG + Intergenic
911884756 1:103283752-103283774 CTCTGATTTATGTATTCCAAGGG - Intergenic
913311406 1:117499768-117499790 TATAAATATATATATTTCAAAGG + Intronic
915379385 1:155426828-155426850 CTCAAATCTGTGTTGTTCAAGGG + Intronic
916128126 1:161589297-161589319 GTAAAGTATATGTATTTCGAGGG + Intronic
916138043 1:161671127-161671149 GTAAAGTATATGTATTTCGAGGG + Intronic
916158767 1:161887590-161887612 GTGAAAAATATGTATTTCTAAGG + Intronic
916307534 1:163355729-163355751 AAAAAATATATATATTTCAAAGG - Exonic
916380350 1:164203394-164203416 CTCAAATCTGTGTTGTTCAAGGG - Intergenic
916531823 1:165663758-165663780 CCCAAATATGTGCATTTCCAGGG + Intronic
916815023 1:168343340-168343362 AGCAAATATATTTATTTCAATGG - Intergenic
917736982 1:177930352-177930374 CTCAGAGATATGTATATGAAGGG - Intronic
918656719 1:187035875-187035897 CTTAAATATATGCATTTTATAGG + Intergenic
918817287 1:189204769-189204791 CTTAAATAAATGAATTTGAATGG - Intergenic
919001623 1:191839146-191839168 CTCAATGATATTTATTTTAAAGG - Intergenic
919086668 1:192928884-192928906 CCCAAATATATGTATTCACATGG - Intergenic
919350637 1:196449357-196449379 CTATAATAAATGTAATTCAATGG + Intronic
919361555 1:196602423-196602445 TTCCAATATATGAATTTCATGGG - Intronic
921071887 1:211666958-211666980 ATTGAATATATGCATTTCAATGG - Intronic
921480988 1:215664659-215664681 CTTCAACATATGTATTTGAAGGG - Intronic
921642373 1:217570411-217570433 CCCCAAAATATGTATTTAAAAGG + Intronic
921932987 1:220770515-220770537 CTCCAACATCTGTATTTGAAGGG - Intronic
922509679 1:226153754-226153776 CAAAAATATATCTATTTCTATGG + Intronic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
923302691 1:232656516-232656538 CTAAAGTATATCTATTTCATTGG - Intergenic
923753286 1:236766957-236766979 ATCAGATATATGTATTATAAAGG + Intergenic
1063146541 10:3299963-3299985 CTCAAAGATATGTATTGTCATGG - Intergenic
1063754450 10:8991388-8991410 CAAAAATATATCTATTACAATGG + Intergenic
1064844009 10:19630989-19631011 CTAAAATAAAAGTTTTTCAAAGG - Intronic
1064852579 10:19725607-19725629 CTCAAATTTATAAATTGCAAGGG + Intronic
1064980024 10:21157134-21157156 CACAAAGATATGCATGTCAAAGG + Intronic
1065390773 10:25178354-25178376 GTAAAATATATGTATTTTCAAGG + Intronic
1065479153 10:26175412-26175434 CTAAAATACATGAATTTCCAGGG + Intronic
1065491146 10:26282976-26282998 CTCAACTATAATTACTTCAAAGG + Intronic
1066131065 10:32394517-32394539 CTTAAATATATTACTTTCAAGGG + Intergenic
1066642778 10:37572880-37572902 CCCAAGAATATGGATTTCAAGGG + Intergenic
1067257307 10:44654291-44654313 CTCACATATATTTATGGCAAAGG - Intergenic
1067676733 10:48386796-48386818 TTAAAATATATATATTTCAATGG - Intronic
1068346266 10:55783117-55783139 TCCAAATATATGAATTACAAGGG - Intergenic
1069257592 10:66353357-66353379 CTCAAATATATATTTTTAAAAGG + Intronic
1069640321 10:69950785-69950807 CTCAAATTTCTCTATTTCAGAGG - Intronic
1070226115 10:74508273-74508295 TTTATGTATATGTATTTCAAAGG + Intronic
1072101377 10:92232456-92232478 CCCAATTTGATGTATTTCAAGGG - Intronic
1072440856 10:95453679-95453701 CTCAAATGTGTGTTGTTCAAGGG - Intronic
1073749868 10:106512973-106512995 TTCCCATACATGTATTTCAATGG - Intergenic
1074718464 10:116243157-116243179 TTCAAATATTTGTATCACAAAGG + Intronic
1074910234 10:117901865-117901887 TTCAAATCTATGTTTTTCAAAGG + Intergenic
1075298428 10:121298608-121298630 CTCAAATTTATGTATTTCTAGGG + Intergenic
1076092998 10:127704593-127704615 TTTAAATATATATATTTTAAAGG + Intergenic
1077221182 11:1417414-1417436 CACACATATATATATTTCATTGG - Intronic
1079540915 11:21573633-21573655 GTCAAAATTATGTAGTTCAAAGG - Intronic
1080003977 11:27385217-27385239 CACAAATATATGGAATTAAAAGG + Intronic
1080221010 11:29904207-29904229 CTCAAATCCATGTTGTTCAATGG - Intergenic
1080509116 11:32949633-32949655 CACAAAAATATGTATGTAAATGG - Intronic
1081169060 11:39844657-39844679 CTCAAATGTATGTTTTATAAAGG - Intergenic
1081294288 11:41366594-41366616 CTACAATATATGAATTTAAATGG - Intronic
1083025348 11:59546117-59546139 CTTAAACATATGAATTTCAAGGG - Intergenic
1083088789 11:60178445-60178467 GACAAATCTATGTATTTAAATGG - Intronic
1083564119 11:63698559-63698581 TTAAAATATGTGTATTTAAAGGG - Intronic
1084366496 11:68704515-68704537 TTAAAATATATATATTTCTAGGG + Intergenic
1085715329 11:78867576-78867598 CTCGATCATATGTATTTCATGGG - Intronic
1086195608 11:84135351-84135373 ATCAAATATACGTTTTTTAAAGG + Intronic
1086797552 11:91126585-91126607 ATGAAATATAAGGATTTCAATGG - Intergenic
1087199855 11:95334519-95334541 CTTCAACATATGAATTTCAAGGG + Intergenic
1087530061 11:99369219-99369241 TATATATATATGTATTTCAAAGG + Intronic
1087685029 11:101252470-101252492 CACACATATATGTAATTCATGGG + Intergenic
1088531178 11:110811509-110811531 CTTCAATATATGAATTTTAAGGG - Intergenic
1088538933 11:110892879-110892901 CTCAAAGATATTTCTTGCAATGG + Intergenic
1090034206 11:123234266-123234288 ATCAAATACATATATTTGAAAGG - Intergenic
1092643835 12:10547631-10547653 CTCAAATAGAGGTGTTTCCAGGG - Intergenic
1093316542 12:17658524-17658546 CTCAGGTATATCTATTTAAAAGG + Intergenic
1093547188 12:20362120-20362142 CTCAAATATCAGTTATTCAAGGG - Intergenic
1093788792 12:23222576-23222598 ATTAAATGTATGTATTTGAAGGG - Intergenic
1093791891 12:23261345-23261367 CTCAAATAATTGTCTTTGAATGG + Intergenic
1094177542 12:27556880-27556902 CTCAAACATATATGTTTGAAGGG + Intronic
1094355661 12:29574820-29574842 CTTCAATATATGAATTTGAAGGG + Intronic
1094788206 12:33876222-33876244 CCCAAATATAACTATTTCTAAGG + Intergenic
1096935044 12:55264295-55264317 ATCAAATATATATATATGAATGG + Intergenic
1097378416 12:58865398-58865420 CTCAAATATGTGGGTTTCACAGG + Intergenic
1098530330 12:71534498-71534520 CTCTTATATATGTTTTTTAAAGG - Intronic
1098583667 12:72131633-72131655 CTCAAATATCGGTTATTCAATGG + Intronic
1098708994 12:73730311-73730333 CTCAAAAAAATGTGTTTTAATGG + Intergenic
1098732995 12:74062630-74062652 GTCAAATAAAGGTATTTCTAGGG + Intergenic
1099047767 12:77744985-77745007 GTGAAATATTTGCATTTCAAAGG + Intergenic
1099501225 12:83416623-83416645 ATCAAATATGTCTATTTAAAAGG - Intergenic
1099588490 12:84553822-84553844 CTCAAATACAAGTATTTGCATGG + Intergenic
1099913970 12:88868646-88868668 CTCAGATATATGTGCTTCAATGG - Intergenic
1099967742 12:89468696-89468718 CTTAAATATATGCATATCCATGG - Intronic
1100270125 12:93016718-93016740 CTCCAACATATGAATTTCAGGGG - Intergenic
1102773833 12:115501901-115501923 TTCAAGTATATGTAGCTCAAGGG + Intergenic
1102781412 12:115568773-115568795 TTCAAATCCATGTTTTTCAAAGG + Intergenic
1102831595 12:116006838-116006860 CTCAAGAATACCTATTTCAATGG + Intronic
1103245029 12:119449398-119449420 AAAAAATATATATATTTCAAAGG + Intronic
1103646564 12:122398112-122398134 CTCAAATAAATTAATTTTAAGGG + Intronic
1104325839 12:127797299-127797321 CTCAAAGAAATTTAATTCAAAGG - Intergenic
1104525833 12:129520497-129520519 TTCAAGTAAATGTATTCCAAAGG - Intronic
1105031110 12:132884514-132884536 CTTAAATATATGAATTTTAGGGG - Intronic
1105548893 13:21373918-21373940 ATCAAAGATAAGTAATTCAAAGG + Exonic
1105653556 13:22407598-22407620 CTGACAGATATTTATTTCAATGG + Intergenic
1105662812 13:22517456-22517478 TGCAAATATCTGTCTTTCAAAGG - Intergenic
1106569485 13:30914209-30914231 CTCACATTTATTTATTTCAATGG + Intronic
1107579974 13:41772593-41772615 CTCAAACATGTGTATTTTCATGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108444461 13:50493513-50493535 ATCACAAATATGTATTTCAGAGG + Intronic
1108874961 13:55035295-55035317 TTCATATATATCTATTTCAGAGG + Intergenic
1109054227 13:57526600-57526622 TATAAATATATATATTTCAAAGG - Intergenic
1109636468 13:65124470-65124492 CTCCAATAAATATGTTTCAAGGG - Intergenic
1109788671 13:67217922-67217944 CTCAAATACATGCCTTACAATGG - Intronic
1110196200 13:72791353-72791375 CTGAAATTCATGTATTTTAAGGG + Intronic
1110205531 13:72908363-72908385 ATTAAATATATTTATTTCTAAGG - Intronic
1110797391 13:79656093-79656115 GTCAAATATAAGTATTCTAAAGG + Intergenic
1110953507 13:81523362-81523384 TTCAAATTTATGTTGTTCAAGGG - Intergenic
1111228742 13:85312215-85312237 CTCATAGACATGTAATTCAATGG + Intergenic
1111247442 13:85558739-85558761 ATAAAATGTATGGATTTCAATGG + Intergenic
1111578209 13:90187002-90187024 CGCAAATATATAAAATTCAAAGG - Intergenic
1111869657 13:93814708-93814730 TTCAAATAGGTTTATTTCAAAGG - Intronic
1112154261 13:96799920-96799942 CACACATATATGTATTCAAAAGG - Intronic
1112464047 13:99628221-99628243 CTTAAATATATATATTTAATGGG - Intronic
1112712607 13:102147649-102147671 CTGAAATATTTGCATTTCAAAGG - Intronic
1112716924 13:102197569-102197591 CATAAATATATTTATTTTAAAGG - Intronic
1112951347 13:105000862-105000884 CTAAAATATATGCAATTCATAGG + Intergenic
1113149519 13:107246949-107246971 CTCAAATAAAAGTACTCCAATGG - Intronic
1113154649 13:107305924-107305946 CTAAGATATATGTATTTTGATGG + Intronic
1113278033 13:108756302-108756324 CTCATACATATATAATTCAAAGG - Intronic
1113617303 13:111689913-111689935 CTTAAATATATGTAAATTAAAGG - Intergenic
1113622832 13:111775183-111775205 CTTAAATATATGTAAATTAAAGG - Intergenic
1113813394 13:113155384-113155406 CACAAAAAAATGTATTTAAAGGG + Intergenic
1114879645 14:26768585-26768607 TCCAAATATATATATTTCATGGG - Intergenic
1115086209 14:29518185-29518207 TTTAAATATTTGTTTTTCAATGG + Intergenic
1115101399 14:29705198-29705220 CTCAAATACATTTATTTCTTGGG - Intronic
1115929464 14:38474752-38474774 CTCAACTATATGTGATTCTATGG - Intergenic
1116273476 14:42801629-42801651 CTCAAATATATGTTTCTGAAAGG + Intergenic
1116280822 14:42904534-42904556 CTGATATATATGAATTTGAAGGG + Intergenic
1116631113 14:47335177-47335199 CTACAATATATGAATTACAAAGG - Intronic
1117084688 14:52187634-52187656 ATCAAATATATGTTTGACAAAGG - Intergenic
1118052433 14:62044008-62044030 TTCAAATCTATGTTATTCAAGGG - Intronic
1120451503 14:84673373-84673395 TTTAAAAATATGTATTTCATTGG + Intergenic
1120640918 14:87011414-87011436 TTCAAATAAAGTTATTTCAAAGG + Intergenic
1121383605 14:93496334-93496356 TTCTTATATATGTATATCAAAGG + Intronic
1121636317 14:95456200-95456222 CTTTAATATTTGTATTTAAATGG - Intronic
1123201419 14:106668961-106668983 TTCCAATATATGTATTTTCATGG - Intergenic
1123584910 15:21750378-21750400 CACAAATACATTTATTGCAAGGG + Intergenic
1124074328 15:26429354-26429376 TGCCAATATATGTTTTTCAATGG - Intergenic
1124435229 15:29643183-29643205 CTAAAATTTCTGTATTTCAAAGG + Intergenic
1124552384 15:30693469-30693491 CTCAACTAAATGCATTTTAAAGG + Intronic
1124678855 15:31712197-31712219 CTCAACTAAATGCATTTTAAAGG - Intronic
1125439473 15:39686699-39686721 CTTCAATATATTTATTTGAAAGG - Intronic
1125454479 15:39843317-39843339 CTCAATCATATGTATTTCAAAGG + Intronic
1125864119 15:43028445-43028467 GCCAAATATATGTATTTTTAAGG - Intronic
1126560945 15:50043364-50043386 TTCAAATTTATGTTGTTCAAGGG - Intronic
1126744352 15:51811138-51811160 CTCAAGTGTATGTTTTTCTAAGG - Exonic
1126875317 15:53034970-53034992 CTCAGATATATGCAGGTCAATGG + Intergenic
1127151879 15:56084227-56084249 CAAATAGATATGTATTTCAAAGG + Intergenic
1127611519 15:60641898-60641920 GTCAAGTATTTGTATGTCAAAGG + Intronic
1127750297 15:62032343-62032365 CTTAAGTATCTGTATTTCTAGGG - Intronic
1129024727 15:72559987-72560009 CTTAAGTATATATATTTCAAAGG + Intronic
1129980870 15:79869310-79869332 CTGAAATATGTCTATTTTAATGG - Intronic
1133939660 16:10297847-10297869 CTCAGACATTTGCATTTCAAAGG + Intergenic
1135273929 16:21094663-21094685 CTCAAATATATATATATATATGG + Intronic
1135843310 16:25895876-25895898 CTTCAATATCTGAATTTCAAGGG + Intronic
1137414930 16:48267298-48267320 CTCAAAAATATATATATGAATGG - Intronic
1137867319 16:51913992-51914014 ATCAAAGATAGGAATTTCAATGG + Intergenic
1138862663 16:60776911-60776933 CTCAAATCTCTGTTTTTCAAGGG - Intergenic
1138917645 16:61486515-61486537 CTTCAACATATGGATTTCAAAGG - Intergenic
1143246511 17:5490791-5490813 ATTAAATATATGTGTTTTAAAGG + Exonic
1144522900 17:15966128-15966150 CAGAAATGTATGTATTTCAGAGG + Intronic
1147793397 17:43026718-43026740 CTCAGATTTATCTAGTTCAATGG - Intronic
1149146288 17:53497354-53497376 GTCAAACATATATGTTTCAAAGG - Intergenic
1149209283 17:54285782-54285804 CTGTAATATATGTTTTTAAAAGG - Intergenic
1149323009 17:55501697-55501719 CCCGAATGTATGTATTTCATGGG - Intergenic
1149960855 17:61108332-61108354 CTCAACTATATGTTTTTTACAGG - Intronic
1153274806 18:3357842-3357864 CTCAAATATATTCAATTAAAAGG + Intergenic
1153932970 18:9895310-9895332 CTTCAATATATGAATTTCAGGGG - Intergenic
1155731082 18:29159276-29159298 TTCAATTAGATTTATTTCAACGG + Intergenic
1155845390 18:30699101-30699123 TTAAAATATATGTATTTCCAAGG + Intergenic
1155901060 18:31390957-31390979 CTCAATTATATAAATTTCATTGG + Intronic
1156092483 18:33488245-33488267 TTTAAAGATATGTCTTTCAAAGG + Intergenic
1156304188 18:35861435-35861457 CACATATATATGTATATAAAGGG - Intergenic
1157928628 18:51794215-51794237 CTCAAACCTATGTTATTCAAGGG - Intergenic
1159176232 18:64838442-64838464 CTGAAAGCTATTTATTTCAATGG - Intergenic
1159253666 18:65916363-65916385 GTCAAATATATATAATGCAATGG + Intergenic
1159347242 18:67222190-67222212 ATCAAGTATATGTTTTCCAATGG + Intergenic
1159416499 18:68155866-68155888 CACAAATATATCTATTTCTGTGG + Intergenic
1159438870 18:68451973-68451995 TTTAAATATATGTATTTGATTGG - Intergenic
1159444402 18:68523366-68523388 TTAAAATATATGTAATTGAAAGG - Intergenic
1159467908 18:68809323-68809345 CTCAAATATAAATATTTATATGG - Intronic
1159565628 18:70045404-70045426 CTAAAATTGATGTCTTTCAAAGG - Intronic
1159987999 18:74868310-74868332 CACAAATATGTGTATGTCTATGG - Intronic
1160370040 18:78364535-78364557 CGCTAAATTATGTATTTCAAAGG + Intergenic
1160624792 18:80195960-80195982 CTAAAATATATATATTGCCAGGG - Intronic
1162635203 19:11962663-11962685 CTGAAACAGATATATTTCAAAGG + Intronic
1163656944 19:18551899-18551921 CTCAGATATGTGTAATTCCAGGG + Intergenic
1164848236 19:31453165-31453187 GTAAAATATTTTTATTTCAAAGG + Intergenic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
1168443324 19:56390520-56390542 ATGATATATATGTATTTCAATGG + Intronic
1168616896 19:57845278-57845300 CTGAAATGTATGTCTTTTAAAGG + Exonic
1168616970 19:57845996-57846018 CTCAAATATGTGTACTTTATTGG - Exonic
925211370 2:2050255-2050277 TTTAAATATATTTCTTTCAAAGG + Intronic
925835939 2:7947029-7947051 CTTAATTATATGTATTTTAATGG - Intergenic
926000161 2:9324224-9324246 CTAAGATATATGTATTTATAAGG - Intronic
926268837 2:11349640-11349662 CTCAAATATATACATTTACACGG - Intergenic
926895398 2:17681996-17682018 CTCAGAAATTTGTATTTAAAAGG - Intronic
927457173 2:23263047-23263069 CTCATATATATGTATGTATATGG - Intergenic
928159646 2:28910601-28910623 ATCAAAAATATATATTACAAAGG - Intronic
928190212 2:29158423-29158445 CTCAAATTTATTTTTTTAAATGG - Intronic
928773178 2:34726424-34726446 CTCAACTTTCTGTATTTCATTGG + Intergenic
928813535 2:35259442-35259464 ATCAAATATATGTAGATAAAGGG + Intergenic
928918344 2:36499043-36499065 CACAAATATATCTGTTTCAGGGG + Intronic
929848726 2:45560635-45560657 CTCAAATATATCTACTTCTTAGG + Intronic
930585778 2:53265120-53265142 TTCAAATAGATGTTTTTCTATGG - Intergenic
931487999 2:62712970-62712992 CTTAAATTTATTTATTTTAAAGG - Intronic
932097581 2:68865248-68865270 CTCAAATGTATGCATATTAAAGG - Intergenic
933367978 2:81378783-81378805 CTCACATCCATGTTTTTCAAGGG - Intergenic
933390777 2:81663905-81663927 ATTAAATGTATGTATCTCAAGGG - Intergenic
933403733 2:81831254-81831276 CTTAAATATATGAATATTAAAGG + Intergenic
933424468 2:82092098-82092120 TTGAATTATCTGTATTTCAAAGG - Intergenic
934902712 2:98173420-98173442 CTCAAATATGTATTTTCCAATGG + Intronic
935062106 2:99617484-99617506 CTCAATTATAAGTTTTTAAAAGG - Intronic
935411060 2:102762794-102762816 CTCAATTAGATGTCTTTAAAAGG + Intronic
936142129 2:109949388-109949410 CTTAAAAATAAGTATTTGAAAGG - Intergenic
936178819 2:110247348-110247370 CTTAAAAATAAGTATTTGAAAGG - Intergenic
936202559 2:110422085-110422107 CTTAAAAATAAGTATTTGAAAGG + Intronic
936709341 2:115113707-115113729 CCCCAAAATATGTATCTCAAGGG - Intronic
936916354 2:117642789-117642811 TGCAAATATATGTTATTCAAAGG + Intergenic
936989787 2:118350458-118350480 TTTAAATATATTAATTTCAAAGG - Intergenic
937719643 2:125079016-125079038 CTCTGTTTTATGTATTTCAATGG + Intergenic
937766836 2:125671255-125671277 TTCAAATCTATGTTGTTCAAGGG - Intergenic
938700705 2:133876584-133876606 CCAAACTATATGTATTTAAAAGG - Intergenic
939034619 2:137115882-137115904 CTCAGATTTATGTAAGTCAATGG + Intronic
939310245 2:140466880-140466902 CTAAAATATCTGAAGTTCAATGG + Intronic
940077803 2:149763033-149763055 ATCAAATATATGTATTATAAGGG - Intergenic
940304032 2:152206455-152206477 ATCAAATATCTGTATTTGCAAGG - Intergenic
940474643 2:154147312-154147334 TACATATATATGTATTTGAATGG + Intronic
941347846 2:164391879-164391901 ATCAAATATAAGTATTCCCAGGG + Intergenic
941503098 2:166306006-166306028 CTCCAATATATGTCTTCCAGTGG - Intronic
941619248 2:167758050-167758072 CTGAAATGTATGAATTCCAATGG + Intergenic
942616609 2:177797279-177797301 CTCAGATCTATCTGTTTCAAAGG - Intronic
942777502 2:179601141-179601163 CTCTAATGTATATATTTCAAAGG - Intronic
943669280 2:190643992-190644014 CTCAAGGAAATGTATTTAAAAGG + Intergenic
943705824 2:191033148-191033170 CTCCAATTTCTGTTTTTCAAGGG - Exonic
944233567 2:197420946-197420968 CTAAAATTTATGGATTTCTATGG + Intronic
944616913 2:201470264-201470286 CTCATCTAAATGTACTTCAATGG - Intronic
945648733 2:212535234-212535256 CTCATATATATATATATAAAAGG - Intronic
945692412 2:213054284-213054306 CTAAAATATATGTTTCTCAAAGG + Intronic
946127185 2:217573275-217573297 CTCAAAAAAATGGAGTTCAAAGG - Intronic
1169779994 20:9299001-9299023 CCCAAATATAAGTATTGCAGAGG + Intronic
1169816597 20:9663453-9663475 TTCAAAGATTTGAATTTCAAAGG - Intronic
1171932670 20:31242457-31242479 CTCAAATAAATGGACTTGAATGG + Intergenic
1172015787 20:31871587-31871609 CTCCAATCACTGTATTTCAAAGG - Intronic
1172922934 20:38501735-38501757 TTCAAATACATGTTGTTCAATGG - Intronic
1172946563 20:38693811-38693833 CTCACATATATTTATCTCACTGG - Intergenic
1173109382 20:40171562-40171584 CTCAAAAATTTGTAATTCACTGG + Intergenic
1173146247 20:40526997-40527019 CTTTAAAATATCTATTTCAATGG + Intergenic
1176950745 21:15043618-15043640 CTCAAAGATTTGTTTTACAATGG + Intronic
1177082701 21:16661002-16661024 CTCATAAATATATATTTTAAAGG - Intergenic
1177563293 21:22784738-22784760 CTTAAGTATTTGTTTTTCAAAGG - Intergenic
1177613328 21:23483367-23483389 CTCAAATCTGTGTTGTTCAAGGG - Intergenic
1178462358 21:32814521-32814543 TTTCAATATATGTATTTTAAGGG + Intergenic
1178963115 21:37086493-37086515 TTTAAAAATACGTATTTCAATGG - Intronic
1179073577 21:38096216-38096238 TTCCAATATATGAATTTTAAGGG - Intronic
1179340158 21:40500259-40500281 ATGAAATATATGTATTTAAAGGG - Intronic
1183379129 22:37482038-37482060 CTCAACTACTTGTATTTCAGGGG + Intronic
1184377399 22:44123355-44123377 CTCAAAATTATGTACCTCAAAGG - Intronic
949278737 3:2320954-2320976 CTAAAATATTTTTATTTCAGTGG + Intronic
949576867 3:5346700-5346722 GTTGAATTTATGTATTTCAAGGG - Intergenic
949651174 3:6161324-6161346 CTCAAATATATGCATTAGGATGG - Intergenic
950990170 3:17426871-17426893 GACAAAAAAATGTATTTCAAAGG - Intronic
951549168 3:23859581-23859603 CTCAAATCTCTGTATTACAAAGG - Intronic
951712425 3:25597912-25597934 ATAAAATATATTTATTTTAAAGG + Exonic
951788665 3:26453769-26453791 CCCACACATATGTATTTTAATGG + Intergenic
951910003 3:27740215-27740237 CTCAAAGCTATATATTTCCAGGG + Intergenic
952261504 3:31744714-31744736 CTCAAATGGATGCATTTCAGAGG - Intronic
952563957 3:34633203-34633225 CTCCAATATATGAATTTTAGGGG + Intergenic
953777260 3:45831064-45831086 CTCAGTTACCTGTATTTCAATGG + Exonic
955115207 3:55991516-55991538 TTCAAGTATATGTATTTAAAAGG + Intronic
955306276 3:57836147-57836169 CTAACATATATGTATTTATAGGG - Intronic
957200636 3:77131016-77131038 CAATAATATATATATTTCAAAGG - Intronic
957423522 3:80004569-80004591 TTCAAATATTTGTCTCTCAAGGG - Intergenic
957522355 3:81335737-81335759 ATTAAATAAATATATTTCAAAGG + Intergenic
957696349 3:83643238-83643260 ATCTTAAATATGTATTTCAAAGG - Intergenic
957706805 3:83798331-83798353 TTCAAAGATATTTATTTCAAAGG - Intergenic
958171578 3:89946121-89946143 TTAAAATACATTTATTTCAAAGG - Intergenic
958520239 3:95176217-95176239 TTGAAATAGATGTATTTCTATGG - Intergenic
959137775 3:102446110-102446132 TTAAAATACATTTATTTCAATGG - Intronic
959261579 3:104088818-104088840 CTCAAAGATGGGTATTTAAAAGG + Intergenic
959282399 3:104361662-104361684 CAGAAATAAATGTATTTCATTGG + Intergenic
959329863 3:104990425-104990447 CTAAAATATATATTTTTAAAAGG + Intergenic
959391724 3:105782974-105782996 CTAAAATAAATATATTTAAATGG + Intronic
959446578 3:106447900-106447922 CTCATATATATGTAGCCCAAAGG - Intergenic
960204636 3:114880530-114880552 CAAAGATATATGTATTTTAAGGG - Intronic
960326433 3:116301609-116301631 CTAAAATTTATGCATTTCATTGG + Intronic
960739902 3:120821607-120821629 CTGAAATACTTGTCTTTCAAGGG + Intergenic
961347413 3:126273151-126273173 CTGAAATATATTTATTTCAAAGG - Intergenic
961908945 3:130293968-130293990 ATCAGATGTATGTATTTCAACGG - Intergenic
962149474 3:132877825-132877847 ATCAAATGTATGTATTTCGAGGG + Intergenic
962337912 3:134553924-134553946 ATAAACTATATTTATTTCAATGG + Intronic
962897399 3:139728663-139728685 CTCACATAACTGTATTCCAAGGG + Intergenic
963544729 3:146642155-146642177 GAAAAATATATGTATTTCAATGG + Intergenic
964139454 3:153380021-153380043 CTCAAATATATGCATCTAATTGG + Intergenic
964820629 3:160764911-160764933 CACAAAAATATTTATTACAATGG - Intronic
965122656 3:164582610-164582632 CTTAAAAATTTGTATTTTAAAGG - Intergenic
965124350 3:164606292-164606314 ATCAAATATGTGTTTTTTAAGGG + Intergenic
965319810 3:167239346-167239368 TTCAAACCTATGTTTTTCAAGGG - Intergenic
965364452 3:167781342-167781364 TTCAAAAATATCTACTTCAAGGG + Intronic
965902903 3:173665697-173665719 TAAAAAGATATGTATTTCAATGG + Intronic
965954251 3:174349166-174349188 TTCAAAGAAATGTATTTCCATGG + Intergenic
966027486 3:175302310-175302332 CACTGACATATGTATTTCAATGG + Intronic
966577787 3:181522286-181522308 CTCCAACATATGAATTTCAGAGG + Intergenic
966782843 3:183599788-183599810 CACAAATATAAATATTTTAAAGG + Intergenic
966897162 3:184454142-184454164 CTCAAATATATATATATATATGG - Intronic
967020712 3:185519982-185520004 CTCAAATATTTCTAATTCAGAGG + Intronic
967337932 3:188364910-188364932 TTCTAATAAATGTATTTCAAAGG + Intronic
967587594 3:191234230-191234252 CTCAAATTTTCCTATTTCAAAGG - Intronic
967631850 3:191753052-191753074 CACACATATATGTTTCTCAAAGG + Intergenic
967641858 3:191874945-191874967 CTCTAAGAAAGGTATTTCAAGGG + Intergenic
967865051 3:194183292-194183314 CTCAAATTTAGGTATAACAATGG + Intergenic
970109748 4:12624586-12624608 CCCAGATCAATGTATTTCAAGGG - Intergenic
970206217 4:13658193-13658215 CTTAAATACATATATTTAAAAGG - Intergenic
971336649 4:25729411-25729433 CCTAAATATATGTATTTAACAGG - Intergenic
971656237 4:29349012-29349034 TTCAAGTATATGTATATCCATGG + Intergenic
971668043 4:29517738-29517760 CTTAAAAATATGTGTTTTAATGG - Intergenic
971739382 4:30501122-30501144 CTCATATTTATATATTTCACTGG + Intergenic
971794581 4:31210227-31210249 CTAAAATACATGTTTTTCAAAGG - Intergenic
971983819 4:33793308-33793330 TTCAAATTTATGTTGTTCAAGGG - Intergenic
971997568 4:33984929-33984951 ATAAAATATATATATTTAAAAGG - Intergenic
973061279 4:45729004-45729026 TTCAAATACATGTTGTTCAAGGG - Intergenic
973151296 4:46891626-46891648 GTCTACTACATGTATTTCAAAGG - Intronic
974890807 4:67880014-67880036 CTCATTTATATGACTTTCAAAGG + Intronic
974911146 4:68121680-68121702 TTTAAATATTTGTATTTCAGTGG + Intronic
975436514 4:74359242-74359264 ATTAAATATATGCATTTAAATGG + Intergenic
975761698 4:77626439-77626461 ATAAAATATTTGTATTTCTATGG + Intergenic
977865457 4:102020984-102021006 TTCCACTATATGTACTTCAAAGG - Intronic
978354534 4:107857716-107857738 AGCAACTGTATGTATTTCAAAGG + Intronic
978862624 4:113469075-113469097 CAAAAATATATGAATTTGAAAGG - Intronic
978894046 4:113864791-113864813 TACAAATATATGTATATAAAGGG + Intergenic
979079584 4:116318340-116318362 CTCCAATAATTTTATTTCAATGG + Intergenic
979308602 4:119175810-119175832 CCCACATTTATTTATTTCAAAGG + Intronic
979738203 4:124116259-124116281 TTCAAATGTATGTTGTTCAAGGG - Intergenic
980518118 4:133891793-133891815 CTAAAATATATATATTTCAAAGG + Intergenic
980664912 4:135919700-135919722 CTCATTTATATGTTTTTAAATGG - Intergenic
980692717 4:136316914-136316936 GTCAAATACATGTATTTTGATGG - Intergenic
980764685 4:137286498-137286520 CTAAAACATATGAATTTCGAGGG + Intergenic
981009146 4:139906684-139906706 GTAAAAAGTATGTATTTCAATGG + Intronic
981152236 4:141392553-141392575 CTTATATATTTGTTTTTCAAAGG + Intergenic
981161365 4:141503052-141503074 CTTAAACATATGAATTTCAGAGG - Intergenic
981402658 4:144331948-144331970 CCCAAATATATCAATTTCACAGG + Intergenic
981707484 4:147676601-147676623 ATCAAATATTTGTTTTTTAAAGG + Intronic
981855017 4:149279020-149279042 CTCATATCTATGTATTTATAAGG + Intergenic
982153521 4:152491919-152491941 CTAAGAAGTATGTATTTCAATGG - Intronic
982269840 4:153575099-153575121 CTCAAATATATTTATTTATTAGG + Intronic
982305904 4:153930402-153930424 CTTAAAAACATGAATTTCAAGGG - Intergenic
982388864 4:154842104-154842126 ATCAGATATATGACTTTCAATGG - Intergenic
982958015 4:161795322-161795344 CTAAATTATCTGTATTCCAAAGG + Intronic
983027218 4:162753283-162753305 CTTGACTATAGGTATTTCAAAGG + Intergenic
984232337 4:177114381-177114403 GTAAAATAAATGTATGTCAAAGG + Intergenic
984383286 4:179023109-179023131 CTCTGATACGTGTATTTCAAAGG + Intergenic
984606825 4:181795476-181795498 CTTCAATATATGAATTTCAGGGG + Intergenic
984623964 4:181984835-181984857 GTCAAATGCATTTATTTCAAAGG - Intergenic
984868133 4:184300464-184300486 TTCAAATTTATGTTGTTCAAGGG + Intergenic
985056790 4:186043176-186043198 TTCATATATGTGTATTTCACAGG - Intergenic
985056796 4:186043242-186043264 TTCATATATGTGTATTTCACAGG - Intergenic
985056802 4:186043308-186043330 TTCATATATGTGTATTTCACAGG - Intergenic
985056820 4:186043506-186043528 TTCATATATGTGTATTTCACAGG - Intergenic
985056826 4:186043572-186043594 TTCATATATGTGTATTTCACAGG - Intergenic
985056832 4:186043638-186043660 TTCATATATGTGTATTTCACAGG - Intergenic
985262049 4:188123782-188123804 CTCAATTATATGTTTTACATTGG + Intergenic
985623554 5:970064-970086 CTTAAATATAGGTATATTAAAGG + Intergenic
986766145 5:10929739-10929761 CTAAAAGAGATGTGTTTCAAAGG - Intergenic
986845532 5:11748342-11748364 CTAAATTATATATATTTAAAAGG + Intronic
987735437 5:21836723-21836745 TTCCAATATATGAATTTTAAAGG - Intronic
987936373 5:24470590-24470612 TACAAATATATGTATTTCAAAGG + Intergenic
987950969 5:24675386-24675408 CTGAGATATATTTATTTCAGAGG + Intergenic
989013226 5:36898396-36898418 CTCAAAAATATCTATCTCATGGG - Intronic
989092639 5:37749858-37749880 GACAAATATTTGTTTTTCAAAGG - Intronic
989534142 5:42544302-42544324 CTCAAATAAATGTAAAACAATGG + Intronic
989750506 5:44887384-44887406 CCTAAATACATGTATTTCTAAGG - Intergenic
990172065 5:53062539-53062561 CTCAGGGATCTGTATTTCAAAGG + Intronic
990209715 5:53469490-53469512 CTCAAATATATGTATCACGGGGG - Intergenic
991436542 5:66601999-66602021 TTCATATGTATGTATTTCATAGG - Intronic
991669026 5:69028692-69028714 GTCATATATATGTATCTCATAGG - Intergenic
991749492 5:69785665-69785687 CTCAAATAATTCTAATTCAAAGG + Intergenic
991993907 5:72368481-72368503 CTAAAATATTTTTTTTTCAAAGG - Intergenic
993157233 5:84241169-84241191 CTCAAATGTAAGTATTTAAAAGG + Intronic
993411719 5:87582005-87582027 CTTTAATATATGAAGTTCAAGGG + Intergenic
993545298 5:89204355-89204377 CTCAAATATCTGTATTTCCAAGG + Intergenic
993688045 5:90965103-90965125 CTAAAATAAATGTATTTCATGGG + Intronic
993770852 5:91924583-91924605 CTAAATTATCTGTAGTTCAATGG - Intergenic
994064855 5:95527415-95527437 ATCAGTTTTATGTATTTCAAAGG - Intronic
994275308 5:97829761-97829783 CTCAGATACATGTATTACCATGG + Intergenic
994977717 5:106831458-106831480 TTCAAACCTATGTTTTTCAAGGG + Intergenic
995040171 5:107578512-107578534 CTGAAAGTTATGTATTTAAAAGG - Intronic
995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG + Intronic
995296336 5:110528135-110528157 CTCCTATAAATTTATTTCAAAGG - Intronic
995534992 5:113126449-113126471 CTCAAATACATGTTGTTCAAAGG - Intronic
995647979 5:114334875-114334897 CTGAAATTCATGTGTTTCAAGGG + Intergenic
996080366 5:119252560-119252582 CTAAATTATATGTAATTTAAAGG - Intergenic
996209334 5:120785946-120785968 CTAAAATATATATATTGCCATGG - Intergenic
996540053 5:124621354-124621376 CTCATATATTTCTATGTCAATGG - Intergenic
996566697 5:124887116-124887138 CTTAAAAGTATATATTTCAAGGG + Intergenic
996645503 5:125810493-125810515 CTCCAAAATATGTACTTCATTGG - Intergenic
996844885 5:127888049-127888071 ATTAAAAATATGTATTTTAAAGG - Intergenic
997008468 5:129848575-129848597 CTCACATATATATACTGCAAAGG + Intergenic
997910331 5:137865650-137865672 CACAAATATAGCTATTTGAATGG - Intergenic
998731715 5:145084847-145084869 CTTCCATATATGTATTTCCAGGG - Intergenic
998792904 5:145785034-145785056 CTAAAATGTTTGTATTTAAAAGG + Intronic
998857477 5:146407331-146407353 CAAAAATACATTTATTTCAAAGG - Intergenic
999116843 5:149171810-149171832 CTCAAACATATCTCTTTGAAGGG + Intronic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
1002115215 5:176956346-176956368 CTCCAATATAAGGATGTCAAAGG + Intronic
1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG + Intronic
1004950619 6:20667094-20667116 GACAAGTATATTTATTTCAAGGG - Intronic
1005028573 6:21487965-21487987 TTCAAATATATTAATTTAAAAGG - Intergenic
1005103307 6:22197407-22197429 CTCAGATATATTTATACCAAAGG + Intergenic
1005502441 6:26441330-26441352 ACCCAATATATGTGTTTCAATGG + Intronic
1005598389 6:27401500-27401522 TTGAAATATATATATTTCAGTGG - Exonic
1005645678 6:27836099-27836121 CAAAAATTAATGTATTTCAATGG + Intergenic
1006564653 6:34944777-34944799 CTCAAATCTGTGTTGTTCAAGGG + Intronic
1007392633 6:41558961-41558983 TAGAAATGTATGTATTTCAAAGG + Intronic
1007685819 6:43666773-43666795 CTCAAATATATGTATATATATGG - Intronic
1007900529 6:45407348-45407370 CTCAGATATATGTAATGCAGGGG + Intronic
1008306026 6:49901112-49901134 TTCAAATCTATGTTCTTCAAGGG - Intergenic
1009532238 6:64832878-64832900 CTGCAATCTAAGTATTTCAAAGG + Intronic
1009724270 6:67516212-67516234 CCCACATATATTTATTTAAAAGG - Intergenic
1009955885 6:70452688-70452710 CCCAAATATATTTCTTACAATGG - Intronic
1010312928 6:74408710-74408732 CTGAGATATATGTATTTCTGGGG - Intergenic
1011239113 6:85252124-85252146 CTCTAAAATATGAATTTCAGTGG - Intergenic
1011414521 6:87103626-87103648 TTCAAATCTGTGTTTTTCAAGGG + Intergenic
1011717307 6:90120983-90121005 CTCAATCATATCTAATTCAATGG - Intronic
1011837749 6:91454983-91455005 CACAAACATATGTATGTAAAAGG - Intergenic
1012397367 6:98814212-98814234 CTCAAAGATAATTATTTAAATGG - Intergenic
1012417874 6:99029374-99029396 CTCAAACATAAGTATGGCAATGG + Intergenic
1013108180 6:107043825-107043847 CTCAAATCTATTTTTTTTAAAGG - Intronic
1013936653 6:115604606-115604628 TACACATATATGTATTTCAGTGG - Intergenic
1014044040 6:116863046-116863068 ATAAATAATATGTATTTCAATGG - Intergenic
1014462767 6:121717460-121717482 CTCAAAAAAATGTATTTCTTAGG + Intergenic
1014516632 6:122386800-122386822 CTCAAATTTACTTATATCAATGG - Intergenic
1014737848 6:125115157-125115179 CACAAATACACATATTTCAATGG - Intergenic
1014917767 6:127173543-127173565 CTAAAAAAAATGTATTTCAAAGG + Intronic
1015357471 6:132295885-132295907 CTGAAACATATTTATTTAAAAGG + Intergenic
1015725068 6:136291386-136291408 ATCAAATGGATCTATTTCAAGGG - Intergenic
1015860699 6:137676085-137676107 CTTAAATTTATCTACTTCAATGG - Intergenic
1015908527 6:138143529-138143551 CTCAAATATCAGTATTTGACAGG - Intergenic
1016078479 6:139826749-139826771 TTCAAATGCATGTTTTTCAAGGG + Intergenic
1016104173 6:140141224-140141246 TTTAAATATATGGTTTTCAATGG - Intergenic
1016150615 6:140737412-140737434 TTCAAATTTTTTTATTTCAATGG + Intergenic
1016212636 6:141558640-141558662 CTAAAATATATGTATGTTTATGG + Intergenic
1017210578 6:151851335-151851357 ATCAAATATATGCAATACAATGG - Intronic
1017295060 6:152783987-152784009 CTCAAATATTTCAATTACAAAGG + Intergenic
1017587426 6:155942546-155942568 CACAAATATTTGTATTTAAGTGG + Intergenic
1017981257 6:159402507-159402529 TACAAATATTTGTATTTAAAGGG - Intergenic
1019402501 7:864055-864077 TTCAAACTTATGTATTTTAATGG + Intronic
1019571460 7:1714455-1714477 CTTAAATACATTTATTTAAAAGG + Intronic
1020370856 7:7430589-7430611 CTAGAATATGTGTATTCCAATGG - Intronic
1020560139 7:9721082-9721104 CTTACACATCTGTATTTCAATGG - Intergenic
1020583843 7:10040054-10040076 GTCAAATATATTTAATTCTATGG + Intergenic
1020605237 7:10328694-10328716 CTAGAATTTATTTATTTCAATGG + Intergenic
1020815887 7:12905424-12905446 TTTAAACATTTGTATTTCAAAGG + Intergenic
1021150598 7:17146320-17146342 CTCAAATGTCTGTTGTTCAAGGG + Intergenic
1021631755 7:22654432-22654454 CTCAATTATATTTACTCCAAGGG - Intergenic
1021682491 7:23148358-23148380 CTTAAATATAGGTATTTGTAAGG - Intronic
1022511835 7:30940276-30940298 CTAAAATATATGTCTTACAAAGG - Intronic
1023058844 7:36310840-36310862 TTAAAATGTATGTATTTGAAGGG + Intergenic
1023449737 7:40270244-40270266 ATTAAAAATATGTGTTTCAAAGG - Intronic
1023673276 7:42602549-42602571 CTCTAAACAATGTATTTCAAAGG + Intergenic
1024449862 7:49527177-49527199 CTCGGTTATATTTATTTCAAAGG + Intergenic
1024752351 7:52482362-52482384 CTCAAATATGTTTACTTAAAAGG + Intergenic
1027899135 7:84086660-84086682 CTCATATATATGTATATATATGG + Intronic
1028009393 7:85621540-85621562 CTCAAATATTTGTTTTTCTTAGG - Intergenic
1028881721 7:95887651-95887673 ATTAAATACCTGTATTTCAAAGG + Intronic
1029531972 7:101131451-101131473 CTCAATTGGATGTATGTCAAAGG - Intronic
1030442952 7:109612075-109612097 CTAAAATAATTATATTTCAAAGG + Intergenic
1030476952 7:110048044-110048066 CTCAAAGATTTGTAACTCAAAGG - Intergenic
1030834655 7:114266772-114266794 CTAAAATATATGAAGTTCAGTGG - Intronic
1030835681 7:114281650-114281672 CTTAAATATATATATTTTATTGG - Intronic
1030938460 7:115615711-115615733 GTGAGATATATGTACTTCAAAGG - Intergenic
1031160413 7:118160813-118160835 GTTTAATATATGTATTTAAAAGG - Intergenic
1031463917 7:122084903-122084925 CTAAAATACATGTATTTCTCAGG - Intronic
1031817366 7:126454582-126454604 CTCCAACATTTGTATTTCGAAGG + Intronic
1032858435 7:135856679-135856701 ATTAAATATATTTATTACAAAGG + Intergenic
1033868416 7:145720162-145720184 TTCAAAAAAATGTATTTTAATGG - Intergenic
1034097515 7:148423967-148423989 CCCTAACATATGGATTTCAAAGG + Intergenic
1035132366 7:156668015-156668037 CTCAAATGTACATATTCCAAAGG - Intronic
1036539647 8:9692876-9692898 ATGAAATATATTTATTTCCATGG + Intronic
1036693505 8:10959709-10959731 CTTCAATATATGAATTTCACAGG + Intronic
1039086146 8:33782035-33782057 GTCAAATATATATTTTTGAAAGG - Intergenic
1039148347 8:34475665-34475687 CTGAATTCTATGTATATCAAGGG + Intergenic
1039632882 8:39132272-39132294 ATCAAATATAGGTATTTATATGG + Intronic
1039671101 8:39599526-39599548 CTTTAATAGATGTATCTCAATGG + Intronic
1039760781 8:40572557-40572579 CTCAAATTTAAGTATATTAATGG + Intronic
1040784829 8:51153537-51153559 CTTAAAAATATATATTTGAAAGG + Intergenic
1040938609 8:52809007-52809029 CTAAAACATCTGTGTTTCAAAGG - Intergenic
1041078693 8:54192959-54192981 CTCAAATCTATGTTGTTTAAGGG - Intergenic
1041349570 8:56935025-56935047 TTCAAAGATTTGTCTTTCAAAGG + Intergenic
1041814482 8:61953484-61953506 TTCAAATACATGTATTTCTTGGG + Intergenic
1042474401 8:69230499-69230521 ATTAAATATATGTATTTAATAGG - Intergenic
1042898187 8:73693626-73693648 GTAAAATATAAGTATTTCCAAGG + Intronic
1043784596 8:84382289-84382311 CTTAAAGATAACTATTTCAAAGG - Intronic
1044078130 8:87848211-87848233 CTTAAACATATGTATTTTAAGGG + Intergenic
1044120626 8:88390225-88390247 CAAAAATAGATGTTTTTCAAAGG - Intergenic
1045042137 8:98235774-98235796 CTAAAGTATTTGTATTTTAATGG + Intronic
1045837295 8:106537214-106537236 CTTCAATATATGAATTTCAAAGG + Intronic
1046365718 8:113228550-113228572 CTCAATGAAATGTATTTAAAAGG - Intronic
1046756309 8:117976298-117976320 CTCATATGTATGTATTTTGATGG - Intronic
1047864566 8:129008074-129008096 CTTATAATTATGTATTTCAATGG - Intergenic
1048050886 8:130814949-130814971 CTCCAATATATGAATTTGAGAGG - Intronic
1048748698 8:137645983-137646005 CACATATATATGAATTTCAAAGG - Intergenic
1049030440 8:140032736-140032758 CTGAAAGATATATTTTTCAAGGG + Intronic
1049938881 9:525661-525683 CTCAAAAATATGAAATTCTACGG - Intronic
1050030899 9:1384129-1384151 CTCATAAATAAGTATTTCACTGG - Intergenic
1051322566 9:15924071-15924093 ATTAAATATATGTTTTTAAAAGG - Intronic
1051408556 9:16765488-16765510 GTCAAATATTTCTATTTAAAAGG - Intronic
1051497547 9:17741337-17741359 CTAAAATACATGTATTTAGACGG + Intronic
1051572107 9:18570513-18570535 TTTAAACATGTGTATTTCAAGGG + Intronic
1051769343 9:20559263-20559285 CTCATACATATGTTTTGCAAAGG - Intronic
1052592047 9:30510454-30510476 CCCAAATAAATTTATTTTAAAGG + Intergenic
1052605552 9:30694621-30694643 CTCAAATTTGTGTTGTTCAAGGG - Intergenic
1054838707 9:69710594-69710616 CTGAAAGATATGCATTTTAAGGG + Intronic
1055068109 9:72139333-72139355 TTTTGATATATGTATTTCAATGG - Intronic
1055123787 9:72694854-72694876 CTTAATTAAATGTATTTTAATGG + Intronic
1056055926 9:82824080-82824102 TTCATATGTATTTATTTCAATGG - Intergenic
1056728177 9:89140924-89140946 CTAAACTATATATATTTAAAAGG - Intronic
1058603105 9:106692477-106692499 CTCAAATTAATGTTTTTAAATGG - Intergenic
1059785388 9:117577249-117577271 TTCAAATATATGAATTTGGAGGG - Intergenic
1059836062 9:118154631-118154653 CTCAAATGTATTTCTTTCAGTGG - Intergenic
1060136570 9:121161331-121161353 TTTAAATATCTGTATTTCAAAGG + Intronic
1186234548 X:7493570-7493592 CACATATATATGTATTTTTATGG + Intergenic
1186260865 X:7777904-7777926 CTCAAATATCAGTAGTGCAAAGG - Intergenic
1186657658 X:11632729-11632751 CACAAATACATGTATTTAAGTGG + Intronic
1186818762 X:13264787-13264809 CTGAGATATGTGTATTTCTAGGG - Intergenic
1186986912 X:15027129-15027151 AATAAAGATATGTATTTCAAGGG + Intergenic
1188140556 X:26545266-26545288 ATTAAATATATGTATATAAAGGG - Intergenic
1188249150 X:27870574-27870596 CTTAAATACATTTATTTCTATGG + Intergenic
1188363535 X:29286106-29286128 CTTAAATATATGCAATTAAATGG + Intronic
1188405752 X:29807166-29807188 ATTTAATATATGTATTTAAATGG - Intronic
1188535221 X:31189503-31189525 TTCAAATCTATGTTTTTCAAGGG + Intronic
1188696224 X:33194985-33195007 CTCAAATACATGGAATTGAATGG - Intronic
1188861293 X:35259682-35259704 CTTCAATATATGTATTTCAAGGG - Intergenic
1189908399 X:45785040-45785062 TACAAATATATATATTTTAAAGG - Intergenic
1191969490 X:66797703-66797725 CTAAACTTTGTGTATTTCAAGGG + Intergenic
1192004847 X:67199452-67199474 CTCAGATTTATGTCTTTCCAGGG - Intergenic
1192193918 X:69016127-69016149 CTTAAATATATATATTTAAAGGG - Intergenic
1192486425 X:71530936-71530958 CTCACATCTATGTATTTCTTTGG + Intronic
1193344801 X:80392960-80392982 GTCACATATATGTCTTTAAAAGG + Intronic
1193370337 X:80688795-80688817 CTAAAATATATTTATGTGAAAGG + Intronic
1193509830 X:82385014-82385036 CCCAAAAATATGAATATCAATGG - Intergenic
1193806041 X:85996047-85996069 CTCAGAGATAAGTATTTTAAAGG - Intronic
1194238804 X:91418664-91418686 GGCAAATAAATGTATTTCATGGG - Intergenic
1194347387 X:92782967-92782989 TTGAAATATATATATTTCAGAGG + Intergenic
1194362043 X:92964194-92964216 ATAAAATATATTTCTTTCAATGG + Intergenic
1194471522 X:94303306-94303328 CTAAAATATAAGCTTTTCAAAGG + Intergenic
1196786155 X:119423216-119423238 CTCAAATCCATGTTGTTCAAAGG + Intronic
1198528708 X:137528041-137528063 CTCAAAAGCATCTATTTCAAAGG + Intergenic
1199012534 X:142774798-142774820 TACAAATATATTTATGTCAATGG - Intergenic
1199044975 X:143159128-143159150 TTCCAACATATGTATTTCAGGGG + Intergenic
1200655710 Y:5899600-5899622 TTAAAATATATATATTTCAGAGG + Intergenic
1200670290 Y:6080409-6080431 ATAAAATATATTTCTTTCAATGG + Intergenic
1201924318 Y:19268162-19268184 CTCAAGGATAAGTTTTTCAATGG - Intergenic