ID: 1004220615

View in Genome Browser
Species Human (GRCh38)
Location 6:13743340-13743362
Sequence AGCACTCGGGCCAGCACCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004220612_1004220615 -5 Left 1004220612 6:13743322-13743344 CCGGGGTGTGAGGGGCTTAGCAC No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220610_1004220615 -1 Left 1004220610 6:13743318-13743340 CCCGCCGGGGTGTGAGGGGCTTA No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220604_1004220615 8 Left 1004220604 6:13743309-13743331 CCTGCCGGCCCCGCCGGGGTGTG No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220611_1004220615 -2 Left 1004220611 6:13743319-13743341 CCGCCGGGGTGTGAGGGGCTTAG No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220606_1004220615 4 Left 1004220606 6:13743313-13743335 CCGGCCCCGCCGGGGTGTGAGGG No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220609_1004220615 0 Left 1004220609 6:13743317-13743339 CCCCGCCGGGGTGTGAGGGGCTT No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220603_1004220615 9 Left 1004220603 6:13743308-13743330 CCCTGCCGGCCCCGCCGGGGTGT No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220600_1004220615 13 Left 1004220600 6:13743304-13743326 CCGGCCCTGCCGGCCCCGCCGGG No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data
1004220598_1004220615 17 Left 1004220598 6:13743300-13743322 CCGGCCGGCCCTGCCGGCCCCGC No data
Right 1004220615 6:13743340-13743362 AGCACTCGGGCCAGCACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004220615 Original CRISPR AGCACTCGGGCCAGCACCTG CGG Intergenic