ID: 1004222271

View in Genome Browser
Species Human (GRCh38)
Location 6:13757042-13757064
Sequence TCCCAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1020377
Summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004222271_1004222277 -8 Left 1004222271 6:13757042-13757064 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG No data
1004222271_1004222279 24 Left 1004222271 6:13757042-13757064 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1004222279 6:13757089-13757111 TCAGGAGTTTGAGACCAGCCTGG 0: 43524
1: 116818
2: 176857
3: 202641
4: 129199
1004222271_1004222278 6 Left 1004222271 6:13757042-13757064 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1004222278 6:13757071-13757093 GGTGGATGGATCATGAAGTCAGG 0: 6
1: 244
2: 3796
3: 18914
4: 40717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004222271 Original CRISPR TCCCAAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr