ID: 1004222277

View in Genome Browser
Species Human (GRCh38)
Location 6:13757057-13757079
Sequence CTTTGGGAGGCGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004222271_1004222277 -8 Left 1004222271 6:13757042-13757064 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004222277 Original CRISPR CTTTGGGAGGCGAAGGTGGA TGG Intergenic
No off target data available for this crispr