ID: 1004222762

View in Genome Browser
Species Human (GRCh38)
Location 6:13760443-13760465
Sequence GACTCACACCCAGGTCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004222762_1004222770 11 Left 1004222762 6:13760443-13760465 CCAGAACGACCTGGGTGTGAGTC No data
Right 1004222770 6:13760477-13760499 ATGTACCAGTGGGGCAGCCTTGG No data
1004222762_1004222771 15 Left 1004222762 6:13760443-13760465 CCAGAACGACCTGGGTGTGAGTC No data
Right 1004222771 6:13760481-13760503 ACCAGTGGGGCAGCCTTGGCAGG No data
1004222762_1004222767 0 Left 1004222762 6:13760443-13760465 CCAGAACGACCTGGGTGTGAGTC No data
Right 1004222767 6:13760466-13760488 CCAGCTCTGGCATGTACCAGTGG No data
1004222762_1004222769 2 Left 1004222762 6:13760443-13760465 CCAGAACGACCTGGGTGTGAGTC No data
Right 1004222769 6:13760468-13760490 AGCTCTGGCATGTACCAGTGGGG No data
1004222762_1004222768 1 Left 1004222762 6:13760443-13760465 CCAGAACGACCTGGGTGTGAGTC No data
Right 1004222768 6:13760467-13760489 CAGCTCTGGCATGTACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004222762 Original CRISPR GACTCACACCCAGGTCGTTC TGG (reversed) Intergenic
No off target data available for this crispr