ID: 1004224382

View in Genome Browser
Species Human (GRCh38)
Location 6:13772573-13772595
Sequence CGGCCGGCTGCTGCGAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004224382_1004224386 -7 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224386 6:13772589-13772611 CCGGCCGGCTCTGCCAGCCTAGG No data
1004224382_1004224395 23 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224395 6:13772619-13772641 GGGCTTAGCACCCGGGCCAGTGG 0: 221
1: 407
2: 219
3: 55
4: 128
1004224382_1004224389 2 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224389 6:13772598-13772620 TCTGCCAGCCTAGGCAATGAGGG No data
1004224382_1004224393 15 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224393 6:13772611-13772633 GCAATGAGGGGCTTAGCACCCGG 0: 275
1: 857
2: 543
3: 178
4: 134
1004224382_1004224388 1 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224388 6:13772597-13772619 CTCTGCCAGCCTAGGCAATGAGG No data
1004224382_1004224394 16 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224394 6:13772612-13772634 CAATGAGGGGCTTAGCACCCGGG 0: 281
1: 642
2: 828
3: 383
4: 198
1004224382_1004224390 3 Left 1004224382 6:13772573-13772595 CCCGCACTCGCAGCAGCCGGCCG No data
Right 1004224390 6:13772599-13772621 CTGCCAGCCTAGGCAATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004224382 Original CRISPR CGGCCGGCTGCTGCGAGTGC GGG (reversed) Intergenic
No off target data available for this crispr