ID: 1004224939

View in Genome Browser
Species Human (GRCh38)
Location 6:13776576-13776598
Sequence TGCTGTGTCCTCACACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004224939_1004224943 9 Left 1004224939 6:13776576-13776598 CCACTCTGTGTGAGGACACAGCA No data
Right 1004224943 6:13776608-13776630 CCATTTGTGAACCAGGAAGTGGG No data
1004224939_1004224941 8 Left 1004224939 6:13776576-13776598 CCACTCTGTGTGAGGACACAGCA No data
Right 1004224941 6:13776607-13776629 GCCATTTGTGAACCAGGAAGTGG No data
1004224939_1004224940 2 Left 1004224939 6:13776576-13776598 CCACTCTGTGTGAGGACACAGCA No data
Right 1004224940 6:13776601-13776623 AAAACAGCCATTTGTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004224939 Original CRISPR TGCTGTGTCCTCACACAGAG TGG (reversed) Intergenic
No off target data available for this crispr