ID: 1004225169

View in Genome Browser
Species Human (GRCh38)
Location 6:13778400-13778422
Sequence TAGTTAGAAAAGATGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004225166_1004225169 13 Left 1004225166 6:13778364-13778386 CCAAGTATATATGATCTGAGTTA No data
Right 1004225169 6:13778400-13778422 TAGTTAGAAAAGATGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004225169 Original CRISPR TAGTTAGAAAAGATGGAACC AGG Intergenic
No off target data available for this crispr