ID: 1004226933

View in Genome Browser
Species Human (GRCh38)
Location 6:13794082-13794104
Sequence ACACATATAAAGAAGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004226933_1004226938 18 Left 1004226933 6:13794082-13794104 CCTACCTGCTTCTTTATATGTGT 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1004226938 6:13794123-13794145 TTTTTTTTTCCATAGAGATGGGG 0: 10
1: 63
2: 950
3: 7845
4: 33653
1004226933_1004226936 16 Left 1004226933 6:13794082-13794104 CCTACCTGCTTCTTTATATGTGT 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1004226936 6:13794121-13794143 TTTTTTTTTTTCCATAGAGATGG 0: 7
1: 70
2: 1348
3: 13256
4: 143585
1004226933_1004226937 17 Left 1004226933 6:13794082-13794104 CCTACCTGCTTCTTTATATGTGT 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1004226937 6:13794122-13794144 TTTTTTTTTTCCATAGAGATGGG 0: 8
1: 61
2: 955
3: 8384
4: 39621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004226933 Original CRISPR ACACATATAAAGAAGCAGGT AGG (reversed) Intronic
900817900 1:4863918-4863940 ACACATTTAAAGCAGTATGTGGG - Intergenic
900970062 1:5987010-5987032 ACACATAAAAACAAGCAGAGAGG + Intronic
902535223 1:17115864-17115886 ATACATAGAAAGAAGGAAGTAGG - Intronic
902907427 1:19568749-19568771 CCACATATAAATAAGCAGAAAGG - Intergenic
904349807 1:29897837-29897859 ACAAATATCAAGACGCAGATAGG - Intergenic
905924190 1:41738214-41738236 AGACATATAGACAAGCAGCTGGG + Intronic
906588339 1:47000714-47000736 AGACAGGTAGAGAAGCAGGTAGG + Intergenic
908186669 1:61658965-61658987 AAAGATTTCAAGAAGCAGGTGGG - Intergenic
908519353 1:64926306-64926328 TCACATATACTGGAGCAGGTAGG - Intronic
908633183 1:66133147-66133169 ACTCAGATACAGAAGCAGGAAGG + Intronic
910175875 1:84429714-84429736 ACACAGATAAAGCAGCACATAGG - Intergenic
910936640 1:92488347-92488369 ACACGCAGAAAGGAGCAGGTGGG + Intergenic
911326757 1:96477538-96477560 AAACAAAGAAAGAAGAAGGTAGG - Intergenic
912143693 1:106764357-106764379 ACACAAAGAAAGAAGAATGTAGG + Intergenic
912873697 1:113333035-113333057 AGGGCTATAAAGAAGCAGGTAGG - Intergenic
914409555 1:147413093-147413115 AGGCATACAAAGAAGCAGGAAGG - Intergenic
914692949 1:150047370-150047392 ACAAGTTTAAAGAAGGAGGTTGG - Intergenic
916257140 1:162800611-162800633 AGACATACAAAGAAGCAGTAAGG - Intronic
916438716 1:164800973-164800995 ACACAGAGAAAAATGCAGGTAGG - Intronic
917050944 1:170922523-170922545 ATAGATATAAAGAAGAAGATAGG + Intergenic
917691787 1:177477303-177477325 AGACACATAAAGAAAGAGGTTGG + Intergenic
918772000 1:188573403-188573425 ACATTTCTAAAGAGGCAGGTAGG - Intergenic
920247319 1:204598168-204598190 ACAAATACAAAAAAGCAGCTGGG - Intergenic
922929997 1:229381501-229381523 ACACACATTAAGCAGCAGGTGGG + Intergenic
924629615 1:245724359-245724381 ACCCATTTAAAGAAGCAGTCTGG - Intergenic
924732547 1:246724780-246724802 ACACATATAGTTAAGGAGGTGGG - Intronic
1063518905 10:6723045-6723067 GCCCTTATAAAGAGGCAGGTGGG + Intergenic
1065112989 10:22458378-22458400 ACACATGTAAAGAAGGACGGGGG + Intergenic
1066326835 10:34368674-34368696 ACAAAAAAAAAGAAGAAGGTGGG + Intronic
1066667403 10:37798679-37798701 ACACATATATACATGCAGGTAGG + Intronic
1067189329 10:44056594-44056616 ACAAATAAAATGAAGCAGGCAGG + Intergenic
1067835705 10:49639731-49639753 ACACATCTAAAGATTCAGGAAGG - Intronic
1068529647 10:58171051-58171073 ACACAGCTAAAGAAGCAAGAAGG - Intergenic
1069259729 10:66380214-66380236 GCACATATACACAAGCAGATTGG - Intronic
1070661492 10:78309644-78309666 AAACATCTCAAGAAGGAGGTAGG + Intergenic
1071431553 10:85610914-85610936 ACACATGGAGAGAGGCAGGTTGG - Intronic
1074674360 10:115831278-115831300 ACACATACAAGGAAGGAGGCCGG - Intronic
1075481698 10:122787809-122787831 ACACATATAAAAAAGCAGCTGGG + Intergenic
1076100347 10:127772732-127772754 ACACTTTTAAAGAAACAGTTAGG - Intergenic
1077981073 11:7301387-7301409 AGTCATATTAAAAAGCAGGTGGG + Intronic
1080111486 11:28572981-28573003 AGAAAGATAAAGAAGGAGGTGGG + Intergenic
1080237534 11:30089277-30089299 TCACCTATCAAGAAGGAGGTTGG - Intergenic
1080487113 11:32720535-32720557 ACACAAATAAATAAACAGATTGG + Intronic
1081443484 11:43106495-43106517 ACACAGATAAAGAGGGAGGATGG + Intergenic
1081633743 11:44706923-44706945 TCTCTTATAAAGAAGCAGGTTGG + Intergenic
1082715102 11:56602614-56602636 ACACTTATAATGAAGCAGGAAGG - Intergenic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1086029888 11:82341605-82341627 ACTTATATAAGGAAGCACGTAGG - Intergenic
1086532789 11:87805775-87805797 ACAGATATACACATGCAGGTTGG + Intergenic
1086645261 11:89211934-89211956 ACACATTTAAAGCAGCGTGTCGG + Intronic
1088296789 11:108306818-108306840 ACACATTTAAAAAAGTAGGCTGG - Intronic
1088691897 11:112335520-112335542 ACACATAGAGAGAAGCAGACAGG - Intergenic
1089081755 11:115782000-115782022 CCACATGTGAAAAAGCAGGTAGG - Intergenic
1089112286 11:116066315-116066337 CCACATATAGTCAAGCAGGTTGG - Intergenic
1089281140 11:117375342-117375364 CCACAGATAAGGAAGCAGGTTGG - Intronic
1090594523 11:128307052-128307074 AAACATATAAGTAAGCATGTAGG + Intergenic
1091618130 12:2065662-2065684 ACAGATTTAAAGAAGAAGGGTGG + Intronic
1093131629 12:15399009-15399031 ACACCTATCAAGAAGGTGGTCGG + Intronic
1093373967 12:18400852-18400874 ATATATATAAAGAAAGAGGTAGG - Intronic
1095835831 12:46637941-46637963 ACTCACTTAAAGAAGCAGTTTGG - Intergenic
1095863439 12:46945543-46945565 AAAAATATAAAGCAGCAGCTGGG + Intergenic
1097922457 12:65090891-65090913 ACCCATAGAAAAAAGCAGCTTGG + Intronic
1100209057 12:92382335-92382357 ACAAATGTAAAGAAGCAACTTGG - Intergenic
1101637548 12:106557942-106557964 ACACTTATAATGGAGCTGGTAGG + Intronic
1104220576 12:126780621-126780643 ACCCTTAGAAAGACGCAGGTTGG + Intergenic
1104496158 12:129241445-129241467 ACACAGATCAGAAAGCAGGTCGG - Intronic
1104561926 12:129853553-129853575 ACTCATATAATGAAACAGATGGG - Intronic
1105237340 13:18569603-18569625 ACACATTGAAAAAAACAGGTAGG - Intergenic
1106670780 13:31902925-31902947 ATACATGTAAAGAAGAACGTGGG + Intergenic
1106806242 13:33310363-33310385 TCACTTATAAAGAAGAAGGCTGG - Intronic
1106867130 13:33977562-33977584 ACACATTTTAAGAAGCATGTTGG - Intergenic
1108083456 13:46761048-46761070 ACGCATATAAAGAAGGAGTTTGG - Intergenic
1108195940 13:47994795-47994817 ACAAGTAATAAGAAGCAGGTAGG - Intronic
1108209278 13:48122041-48122063 AGACATGTAAAGAAGCTGCTAGG - Intergenic
1108532639 13:51341914-51341936 ACAGATTTATAAAAGCAGGTTGG - Intronic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1110704923 13:78594510-78594532 AGGCATTTAAAAAAGCAGGTAGG - Intergenic
1110778291 13:79434943-79434965 ACTCAAATAAAGAAGCAAATGGG + Intergenic
1112444559 13:99452332-99452354 AGACATAGAAAGAAGCAGAGTGG + Intergenic
1112731293 13:102365719-102365741 ACATATATACATAAACAGGTTGG - Intronic
1113144886 13:107197542-107197564 CCACACATGAAGAAGCAGGCAGG - Intronic
1114350458 14:21844751-21844773 ACACAAATACAGAAGCAGGTTGG + Intergenic
1114354517 14:21892562-21892584 ACACAAGTACAGAAGCAGGATGG + Intergenic
1115122877 14:29958527-29958549 ACACATTTAAAGCAGCGTGTAGG - Intronic
1115232287 14:31174068-31174090 ACACATATAAAGAATCTAGATGG + Intronic
1116636939 14:47408652-47408674 ACACAAATATAGAGGCAGCTTGG - Intronic
1117152116 14:52900369-52900391 ATACATATAAAAAAGCATGAGGG + Intronic
1117829301 14:59733885-59733907 ACACACTTAAAGAAGCAGTCTGG - Intronic
1117906556 14:60594863-60594885 ACACTTAGAAAGAAGGAAGTGGG - Intergenic
1118567638 14:67159776-67159798 AAACAGATAAAGAAGCAGTTTGG - Intronic
1120960272 14:90118186-90118208 ACACATATGTAGAAGCATGATGG - Intronic
1121508861 14:94497128-94497150 ACACATGTACACAAACAGGTTGG - Intronic
1128921093 15:71610916-71610938 ACACATATAAATATGCATGTAGG - Intronic
1129695540 15:77738892-77738914 TCCCATATGAAGAAGCAGGCAGG + Intronic
1131838457 15:96413027-96413049 ACTCCTCTAAAGAAGGAGGTTGG + Intergenic
1132108537 15:99084884-99084906 ACACATATAAAGAACAAAGCAGG + Intergenic
1134604380 16:15558692-15558714 ACATATGTAAGGAAGCCGGTGGG + Intronic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135805939 16:25542696-25542718 AGACATTTAAAGATGCTGGTAGG - Intergenic
1137263234 16:46847767-46847789 ACAGAAAGAAAGAACCAGGTTGG + Intergenic
1137580238 16:49629206-49629228 ATAAATATAAAGACACAGGTAGG - Intronic
1138837659 16:60458185-60458207 GCAGGTATAAAGAAGCAGGCTGG - Intergenic
1139243082 16:65413983-65414005 ACACACAGAAAGAATCAGTTTGG - Intergenic
1139243182 16:65415314-65415336 ACACACAGAAAGAATCAGTTTGG + Intergenic
1139831649 16:69803571-69803593 ACACACACAAAAAAGCAGGGTGG - Intronic
1140073444 16:71674051-71674073 CCACATATAAAGCAGAATGTAGG - Intronic
1140464420 16:75168336-75168358 ACACATTGAAAGAAGTAGGCTGG + Intronic
1141289443 16:82704138-82704160 AGACAAATAAAGAAAGAGGTGGG + Intronic
1142225606 16:88875885-88875907 ACACATATGGAGACGCAGGCCGG + Exonic
1144226638 17:13155676-13155698 ACATAGGTAAAGAAGAAGGTTGG - Intergenic
1145362337 17:22222407-22222429 AAACTTATGAAGAAGCATGTGGG - Intergenic
1146185502 17:30721647-30721669 ACAAATATAAAAAAGTAGCTGGG - Intergenic
1146817077 17:35951014-35951036 ACATATATAAAGATGAAGATAGG + Intergenic
1147229190 17:39004773-39004795 ACGCATGTAGAGAAGCAGGATGG - Intergenic
1148777329 17:50102937-50102959 CCACATAGTAAGCAGCAGGTTGG - Intronic
1149318211 17:55458611-55458633 ACACATCAAAAGGAGCACGTCGG + Intergenic
1149336702 17:55643222-55643244 ACACACATAAAGAAACAGGATGG - Intergenic
1149826385 17:59832405-59832427 AAACAAAAAAAGAAGTAGGTTGG - Intronic
1151249532 17:72823057-72823079 ACACATATAAAGGAAAAGCTGGG + Intronic
1151589584 17:75034520-75034542 ACACCTATCAAGGAGCACGTGGG - Intronic
1154134744 18:11766430-11766452 AAAGATATAAAGGAGCAGGGAGG + Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1155388028 18:25302281-25302303 ACACCAGTAAAGAAGCAGGCAGG + Intronic
1155894529 18:31307888-31307910 ACAAATATAAAGAAATAGGATGG - Intergenic
1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG + Intergenic
1158495100 18:57948210-57948232 ACACATATTAAGAGGCTGATAGG + Intergenic
1158814418 18:61077316-61077338 ACTCTTCTAAACAAGCAGGTTGG + Intergenic
1159881039 18:73858791-73858813 ACACATTTCATGAGGCAGGTGGG + Intergenic
1162973283 19:14194081-14194103 ACAAATATAAAAAAGTAGCTGGG + Intronic
1164265255 19:23610059-23610081 ACTGATTTAAAGAAGCAGATTGG + Intronic
1165680374 19:37769266-37769288 ACACATAAAAATAAACAGGTAGG - Intronic
1167900149 19:52615434-52615456 AGACACAGCAAGAAGCAGGTTGG + Intronic
1167968602 19:53170475-53170497 ACTCATAGAAAGAAGAACGTTGG - Intronic
925323960 2:3001375-3001397 ACACATTTACATCAGCAGGTAGG - Intergenic
926071176 2:9893246-9893268 ACACAGATACACAAGTAGGTAGG - Intronic
926623947 2:15074319-15074341 ACACATGGAAAGAAGAAGGGAGG + Intergenic
927368468 2:22326903-22326925 ACACACAGAGAGAAGAAGGTGGG + Intergenic
928444850 2:31324662-31324684 ACTCATATAAAGAATGAGGTGGG + Intergenic
928737311 2:34307082-34307104 ACACATATAAGGTTGAAGGTTGG - Intergenic
929634868 2:43508608-43508630 ACAAATATAAACAAACAGCTAGG + Intronic
931004960 2:57839201-57839223 ACACATATACACTAGCAAGTAGG + Intergenic
932260214 2:70320757-70320779 ACACTTGTCAAGAAGCAGGAAGG - Intergenic
932324193 2:70845164-70845186 ACACATTTAAAGCAGTATGTAGG + Intergenic
932676701 2:73787893-73787915 TCACATATAAAAGAGCAGGATGG + Intronic
932677286 2:73792790-73792812 TCACATATAAAAGAGCAGGATGG + Intronic
932677871 2:73797688-73797710 TCACATATAAAAGAGCAGGATGG + Intronic
932678457 2:73802588-73802610 TCACATATAAAAGAGCAGGATGG + Intronic
932679041 2:73807488-73807510 TCACATATAAAAGAGCAGGATGG + Intronic
936021375 2:108997531-108997553 ACAGATAGAAAGAGGCAGGATGG + Intergenic
936862038 2:117030096-117030118 TCCCATATAAAGAAGCAGTCTGG - Intergenic
938512437 2:131964900-131964922 ACACATTGAAAAAAACAGGTAGG + Intergenic
939233947 2:139467385-139467407 AAACATATAAAGAAGAGGGTAGG + Intergenic
940112049 2:150165812-150165834 ACTCATATTAAGCAGCAGGAAGG + Intergenic
941529349 2:166646902-166646924 ACACATGTAAAGAAACAGGAAGG - Intergenic
942209551 2:173656953-173656975 AAAAATATCAAGAAACAGGTGGG - Intergenic
942959612 2:181814113-181814135 CAACATATAAAGGAGCAGGAGGG + Intergenic
943052566 2:182933979-182934001 ATATATATAAAACAGCAGGTTGG - Intronic
943198375 2:184785658-184785680 ACATATATAAATAAATAGGTAGG + Intronic
943209388 2:184943519-184943541 AAACAGATAGATAAGCAGGTAGG - Intergenic
943282375 2:185952301-185952323 ACACATATTAAGAAATAGATGGG - Intergenic
945504731 2:210625782-210625804 ACACATAGTGAGAAACAGGTAGG + Intronic
945736698 2:213609694-213609716 AGACATATAAAGTGGCAGTTTGG - Intronic
945900127 2:215527782-215527804 ACACATATACAGGAGAATGTGGG + Intergenic
945914929 2:215693534-215693556 ATACAGAAAAAGGAGCAGGTGGG + Intergenic
946123069 2:217533330-217533352 ACACAGATACACAAGCAGCTGGG + Intronic
946540730 2:220681715-220681737 ACACATTTCAAGAACCAGGGTGG + Intergenic
947256196 2:228166596-228166618 ACATATATAAAGAATGAGGCAGG - Intronic
948044742 2:234935094-234935116 ACACAAAAAAAGAATCAGTTTGG - Intergenic
1170536460 20:17345848-17345870 ACACCTGTAAAGGAGCAGCTGGG + Intronic
1173050461 20:39554842-39554864 CCACAGAGACAGAAGCAGGTCGG + Intergenic
1173073501 20:39793379-39793401 AAACATGTAAAGCAGCATGTTGG - Intergenic
1173371112 20:42436697-42436719 GCACATATACAGGAGAAGGTAGG + Intronic
1173384498 20:42575162-42575184 ACACATAGAAAGACGCAGGAAGG + Intronic
1173845306 20:46184543-46184565 ACACAAATAAAAAAGTATGTTGG - Intronic
1174027098 20:47586320-47586342 ACAAATACAAATAAGCAAGTGGG - Intronic
1174966311 20:55220155-55220177 ATAAATATAAATAAGTAGGTAGG - Intergenic
1175122055 20:56723395-56723417 ACACAGGTAAAGAAACAGGCAGG - Intergenic
1175354209 20:58349847-58349869 ACACATATGAAGAAACAGGAAGG + Intronic
1176643965 21:9332207-9332229 AGACCTATAAAGAACCAGGATGG - Intergenic
1176781327 21:13197886-13197908 ACACATTGAAAAAAACAGGTAGG - Intergenic
1177736857 21:25101820-25101842 ACACATATACAGACCCAGGAAGG + Intergenic
1178505543 21:33159814-33159836 ACACATTGCAAGCAGCAGGTGGG + Intergenic
1180846783 22:18987316-18987338 ATACATATAAATAAGTAGGCTGG + Intergenic
1181758517 22:25041726-25041748 AAACAAACAAAGAACCAGGTGGG - Intronic
1183257560 22:36772133-36772155 ACACAGATAAAGATGAAGGAGGG - Intronic
1183816355 22:40304562-40304584 ACTCATATAAATAAGTAGATGGG - Intronic
949665800 3:6337993-6338015 ACATATAGAAAGATCCAGGTCGG - Intergenic
950665025 3:14490116-14490138 ACACATAGAGAGAGGCAGGCAGG - Exonic
952006519 3:28847757-28847779 AAGCATATACAGAAGTAGGTTGG - Intergenic
952646478 3:35664934-35664956 ACACACACAAAATAGCAGGTGGG - Intronic
954732395 3:52675811-52675833 ACACATATAAAGAATGAAGCGGG + Intronic
955397319 3:58566457-58566479 ACATTTCTACAGAAGCAGGTGGG + Exonic
955463114 3:59207460-59207482 ACACATAAAAAGAAGCAACATGG + Intergenic
956842123 3:73150312-73150334 AGACTTCTAAAGAAACAGGTGGG - Intergenic
958645546 3:96867906-96867928 ACAAATTTAAAGAAGCAAATGGG - Intronic
959022486 3:101203497-101203519 ACACAGATAGAGAAGCAGCCAGG - Intergenic
959664524 3:108905885-108905907 ACGTAGAAAAAGAAGCAGGTGGG - Intergenic
960836857 3:121915738-121915760 ACACATGTAAAGCATCATGTAGG + Intronic
960874339 3:122282179-122282201 ACACACTCAAAGCAGCAGGTGGG - Exonic
961251100 3:125506220-125506242 AGGCATATAAAGAAACAGGGTGG + Intronic
961933579 3:130559608-130559630 AAATATTTAATGAAGCAGGTTGG - Intergenic
962297516 3:134205118-134205140 AAAGATAAAAATAAGCAGGTTGG + Intronic
962561783 3:136613855-136613877 GCACATATAAAGAATCAGTCTGG - Intronic
962585502 3:136839405-136839427 GCACTTTTAAACAAGCAGGTTGG - Intronic
963532832 3:146492633-146492655 ACACAGCTAAAGAAGTAGGAAGG + Intronic
964758170 3:160107639-160107661 GGACATATGAGGAAGCAGGTAGG + Intergenic
965962584 3:174446121-174446143 ACATTTATAAACAAGCAGTTAGG - Intronic
966859134 3:184218999-184219021 ACTCATAGGGAGAAGCAGGTGGG + Intronic
967291905 3:187929570-187929592 CCACATGTACAGAAGCAGGCTGG + Intergenic
968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG + Intronic
968796366 4:2708080-2708102 ACACAAATAAATAACCAGTTAGG - Intronic
970211351 4:13713364-13713386 ACACATGTGAAGATGCAGGCAGG + Intergenic
971861053 4:32106525-32106547 ACACAGATTAAGAAACAGGCAGG + Intergenic
975170399 4:71226021-71226043 AAACCTATAAAGAAGCTGGATGG - Intronic
975224362 4:71853951-71853973 ACATATTTAAAGAAGGAAGTTGG - Intergenic
975490924 4:74987784-74987806 TCAGATGTAAAGAAGCAAGTTGG + Intronic
976143237 4:82015124-82015146 ATACATATAAAGAAGCAAGAAGG + Intronic
976565955 4:86551170-86551192 ACACATATACATATGCAGTTTGG - Intronic
977892218 4:102325682-102325704 GCAGATATAAAGAAGCAGAAAGG - Intronic
978227855 4:106360228-106360250 ACACATATGAAGAAAAAGTTTGG - Intergenic
978984182 4:114988659-114988681 ACACATTTAAAGACGTATGTAGG - Intronic
981251012 4:142600818-142600840 GCACATATAAAGTAAAAGGTTGG + Intronic
982007342 4:151076204-151076226 ACTAAAATAAAGAAGCACGTGGG - Intergenic
982100664 4:151964578-151964600 ACACAAATAAATAAACATGTGGG - Intergenic
982847411 4:160271330-160271352 AGAAACATAATGAAGCAGGTTGG + Intergenic
983650966 4:170035838-170035860 ACAGAATTTAAGAAGCAGGTAGG + Intergenic
984230707 4:177095036-177095058 TCACATATAGAGTAGAAGGTTGG + Intergenic
984521386 4:180806135-180806157 AGACATATAAAGAAAAATGTAGG - Intergenic
985148114 4:186915712-186915734 ACACAAACCCAGAAGCAGGTTGG - Intergenic
1202758717 4_GL000008v2_random:89611-89633 ACACTTATGAAGAACCAGGATGG - Intergenic
985565747 5:615567-615589 TCAAATATAAAGATACAGGTAGG - Intronic
986219049 5:5750549-5750571 GCACAGATGAAGAGGCAGGTAGG + Intergenic
987913075 5:24175170-24175192 ACACATATACAGGATAAGGTAGG + Intronic
990398074 5:55404966-55404988 ACACATACAAAAAATCAGCTGGG - Intronic
990942593 5:61218071-61218093 ACACATCTATAGAAAAAGGTGGG + Intergenic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
991473223 5:66991879-66991901 ACACACAGAAAAAAGCAGGAAGG - Intronic
993226160 5:85168831-85168853 ACCCACATAAAAAAGCAGTTTGG + Intergenic
994013519 5:94937499-94937521 ACACAAATAAAGAAGAAAGTAGG - Intronic
994231088 5:97311231-97311253 AGACATCTAAAGAAGCGGGAAGG + Intergenic
994760720 5:103849453-103849475 ACACATATTAAGAAGCATGCTGG + Intergenic
995403222 5:111764835-111764857 ACACATATAAAGAATTATGAAGG + Intronic
995413819 5:111887322-111887344 GCACATATGAAGACGGAGGTTGG + Intronic
995455596 5:112348563-112348585 ACTCACATAGGGAAGCAGGTGGG + Intronic
997110397 5:131068011-131068033 ACACTTAGAAATAAGCAGCTGGG - Intergenic
998293533 5:140941614-140941636 ACAGAAATTAAGAAGCAGGATGG - Intronic
998455244 5:142267222-142267244 AAACATTTAAAGAAGCATGTTGG - Intergenic
998564885 5:143208015-143208037 ACACAGAGACAGAAGCAGGCTGG - Intronic
998984453 5:147740299-147740321 ACAGATATAAAGAAGAAATTGGG + Intronic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
1001079908 5:168660124-168660146 TCACAAGGAAAGAAGCAGGTTGG - Intergenic
1004113557 6:12745512-12745534 ACACATATAAACAATCATGTGGG + Intronic
1004226933 6:13794082-13794104 ACACATATAAAGAAGCAGGTAGG - Intronic
1004609638 6:17227528-17227550 ACAAATATAAAGCAGCAGGCAGG + Intergenic
1005784182 6:29226035-29226057 ACATGGATATAGAAGCAGGTGGG - Intergenic
1006234804 6:32619955-32619977 ATACATAGAAAGAAACAGGTTGG + Intergenic
1006396826 6:33793116-33793138 ACACATCTAAACAAGCAGCCAGG + Intergenic
1007287368 6:40757360-40757382 ACACAGAGAGAGAAGCAGGTTGG + Intergenic
1007723257 6:43898658-43898680 ACACACATAAAGATTCAAGTAGG - Intergenic
1008752048 6:54746711-54746733 ACAAATTTAAAGAAACAGGCTGG - Intergenic
1008881204 6:56382430-56382452 AGACAGAGAAAGAAGGAGGTGGG - Intronic
1009596577 6:65744893-65744915 ACCCATTTAAAGAAGCAGTCTGG - Intergenic
1010253989 6:73737392-73737414 ACACCCATAAAGATGCAGGGTGG - Intronic
1012063134 6:94512206-94512228 ACACATTTAACGAAGCACCTTGG - Intergenic
1012764688 6:103351884-103351906 AGAGAAATAAAGAGGCAGGTAGG - Intergenic
1015845184 6:137513089-137513111 CCACATACAAAGAAGCACTTGGG - Intergenic
1016417804 6:143851342-143851364 ACATATCTGAAGAAACAGGTAGG + Intronic
1017080382 6:150662704-150662726 ACACATTTAAAGATGGAGCTTGG - Intronic
1021093014 7:16504984-16505006 ACACACACAATGAAGCAAGTAGG - Intronic
1022283579 7:28934303-28934325 ACACATCTAAAGAACCAGGCTGG + Intergenic
1022389685 7:29932724-29932746 AGACATACAAATAAGGAGGTGGG + Intronic
1022843480 7:34187781-34187803 ACAAATAGAGAGAAGCAGATAGG + Intergenic
1024580643 7:50797677-50797699 ACATATATAAAAAATCAGCTGGG - Intergenic
1027389305 7:77689663-77689685 ACACATAAAGATGAGCAGGTCGG + Intergenic
1028242513 7:88438399-88438421 ACACATTTGAAGAAGCAAGGGGG - Intergenic
1028290804 7:89062800-89062822 ACAAATATAAATAAGTATGTAGG - Intronic
1028510320 7:91618172-91618194 ACAAATATGAAAAATCAGGTTGG - Intergenic
1029366985 7:100122889-100122911 ACATACCTCAAGAAGCAGGTAGG + Exonic
1030267604 7:107636264-107636286 ACCTATATAAAGAAGCCTGTAGG - Intergenic
1031699809 7:124910089-124910111 ACACATATAAAAAACCTGGAAGG + Intronic
1031765809 7:125775635-125775657 GCAGATTTAAAGAACCAGGTTGG + Intergenic
1031930239 7:127678142-127678164 ACACATACAAACAAGCATTTGGG - Intronic
1033091526 7:138390495-138390517 AAACATTTAAAGAAGCAGATTGG - Intergenic
1033914364 7:146305733-146305755 ACACATTTAAAGCAGCGTGTAGG + Intronic
1034913255 7:155015693-155015715 ACATGTACAAAGAAGCAGATTGG + Intergenic
1035902442 8:3471844-3471866 ACACAGTTAAAGAAGAATGTGGG + Intronic
1036082237 8:5569425-5569447 ATAAATATATAGAAGGAGGTAGG + Intergenic
1036280880 8:7400454-7400476 ACACATAAAAAGAACCAAATGGG - Intergenic
1036340585 8:7911117-7911139 ACACATAAAAAGAACCAAATGGG + Intergenic
1038207024 8:25476468-25476490 ACACATACAGAGATGCAGGAGGG - Intronic
1038292683 8:26263996-26264018 ACACATATAATCAAGCAGTATGG - Intergenic
1039430715 8:37523079-37523101 ACACAGATAAAGAAGCAAGCTGG + Intergenic
1039590549 8:38743013-38743035 ACACAAGTAAAGAAGTAAGTTGG - Intronic
1040092032 8:43408616-43408638 ACCCATTTAAAGAAGCAGTCTGG + Intergenic
1040373879 8:46803854-46803876 ACACAAATAAAGAGGCAGTCAGG + Intergenic
1040400611 8:47045817-47045839 ACCCATTTAAAGAAGCAGTTTGG - Intergenic
1041563116 8:59243185-59243207 ACACTGATAAAGAAGGAGGCAGG - Intergenic
1041565293 8:59270497-59270519 ATACATATAGATAAACAGGTAGG - Intergenic
1041658643 8:60378903-60378925 ACACAGAAAAAGAAGTAGCTGGG + Intergenic
1043309005 8:78834891-78834913 AGCCATAAAAAAAAGCAGGTTGG - Intergenic
1043381177 8:79703864-79703886 ACACATATAAAGAATCTTGTAGG + Intergenic
1043980155 8:86628631-86628653 ACACATACAAAAAAGGAAGTGGG - Intronic
1044503262 8:92987909-92987931 ACACAGATACAGATGCAGATAGG + Intronic
1044805995 8:96008911-96008933 ACACACACACAGAAGCAGGGAGG - Intergenic
1045175555 8:99720752-99720774 AAAGATATAAAGAAGCTAGTTGG - Intronic
1045604894 8:103761786-103761808 ACACATATTTATAAGCAGGTTGG + Intronic
1046957058 8:120072606-120072628 AAACATACAGAGAAGCATGTAGG + Intronic
1047324804 8:123825959-123825981 ACTTAAATAAAGAAGCTGGTAGG - Intergenic
1047451545 8:124969509-124969531 ACATATGTATATAAGCAGGTAGG + Intergenic
1047682943 8:127273625-127273647 ACACATATTCAGGAGCAGGTTGG - Intergenic
1047736706 8:127772062-127772084 ACATTTATAAAGAAACAGGCTGG - Intergenic
1052051638 9:23855172-23855194 CCACATAGGAAGAAGCAGGTAGG - Intergenic
1053754579 9:41292514-41292536 ACACATATATAGATGGAGTTAGG + Intergenic
1054260100 9:62856820-62856842 ACACATATATAGATGGAGTTAGG + Intergenic
1054388885 9:64594349-64594371 TCACATAGAAAAAAGAAGGTTGG + Intergenic
1055095257 9:72406629-72406651 AAAGTTTTAAAGAAGCAGGTAGG - Intergenic
1055130795 9:72771919-72771941 ACAAATATCAAAGAGCAGGTGGG - Intronic
1055201999 9:73676011-73676033 ACTCATTTAAACATGCAGGTCGG + Intergenic
1055692943 9:78853279-78853301 AAAAATATGAAGAAGAAGGTAGG - Intergenic
1056394181 9:86166531-86166553 AAAAATACAAAAAAGCAGGTTGG + Intergenic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057682477 9:97202176-97202198 ATAGATATAAAAAAACAGGTAGG + Intergenic
1058175402 9:101730111-101730133 ACCCATATAAAGGAGCAACTAGG + Intronic
1058856054 9:109063415-109063437 ACACATATATGGAATCAGGCTGG - Intronic
1059323339 9:113486282-113486304 AGACAACTAAAGAAGAAGGTTGG + Intronic
1202799046 9_KI270719v1_random:156182-156204 ACACATATATAGACGGAGTTAGG - Intergenic
1203711557 Un_KI270742v1:102785-102807 AGACCTATAAAGAACCAGGATGG + Intergenic
1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG + Exonic
1188079290 X:25816064-25816086 ACACATATAAGTAAGTAAGTAGG + Intergenic
1188133146 X:26462633-26462655 TCAGATAGAAAGGAGCAGGTGGG - Intergenic
1191096678 X:56680449-56680471 AGACATATAATGAAGTTGGTTGG - Intergenic
1191910789 X:66147221-66147243 AAAGATAGAAAGAAGAAGGTAGG - Intergenic
1192723349 X:73723606-73723628 ACCCACTTAAAGAAGCAGGCTGG + Intergenic
1192822015 X:74656150-74656172 ACCCATTTAAAGAAGCAGTCTGG + Intergenic
1192926259 X:75758360-75758382 ACCCATTTAAAGAAGCAGACTGG - Intergenic
1194549923 X:95284882-95284904 ACACATACACAGAAATAGGTTGG - Intergenic
1194715336 X:97281446-97281468 ACACATACAAAGAAGGAGGCCGG + Intronic
1194917355 X:99722463-99722485 ACACACTTAAAGAAGCAGTCTGG - Intergenic
1195768302 X:108320024-108320046 ACATAGATACAGATGCAGGTAGG + Intronic
1195925531 X:110020998-110021020 GCACATATAAAGAGGCTGCTTGG - Intronic
1196436182 X:115676680-115676702 ACAAAAATAAAGAAGCAGCTTGG + Intergenic
1196890614 X:120287327-120287349 ACACACACACAGAAGCAGGCAGG + Intronic
1197266225 X:124375241-124375263 ACACACATAAAAAAGCAGCAGGG + Intronic
1197354642 X:125422942-125422964 GCACATATAAAGAAGCCCATAGG + Intergenic
1197427964 X:126321878-126321900 ACACATATAAAAAAACTTGTCGG - Intergenic
1197615092 X:128681892-128681914 TCACATATATGGCAGCAGGTGGG + Intergenic
1197783190 X:130176690-130176712 ACACACAGAAAGAAGCAGCAAGG - Intronic
1201264934 Y:12197037-12197059 ACACACTTCAAAAAGCAGGTGGG - Intergenic
1201474138 Y:14362693-14362715 ACACATTTAAAGAAACATATTGG - Intergenic