ID: 1004227192

View in Genome Browser
Species Human (GRCh38)
Location 6:13796819-13796841
Sequence ACCTGGGAAAAACTACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004227192 Original CRISPR ACCTGGGAAAAACTACATCA AGG (reversed) Intronic
900526113 1:3129618-3129640 ACCTGGGAGAACCTGCTTCAAGG - Intronic
901569862 1:10151541-10151563 ACCTGTATAAAACTTCATCAGGG - Exonic
903819243 1:26088656-26088678 ACCTGGAAAAAAGTAAAACAAGG + Intergenic
904065887 1:27750488-27750510 ACCCTGCAAAAACTACTTCAAGG + Intronic
905714458 1:40136113-40136135 AACTAGTAGAAACTACATCATGG - Intergenic
906071490 1:43019959-43019981 AACAGGGAAAAAGTCCATCAGGG - Intergenic
909354902 1:74697203-74697225 AGCTGGGAAATACGAGATCAAGG - Intergenic
909694366 1:78449456-78449478 ACCTGGGTACAAGTATATCAAGG - Intronic
909966250 1:81914536-81914558 ACCTGGGATAAATAACATAAGGG - Intronic
910504255 1:87931227-87931249 AAAGGGGAAAATCTACATCAAGG + Intergenic
911049713 1:93660410-93660432 ACCAGGGAGAAACTTAATCAGGG + Intronic
913367323 1:118054559-118054581 ACCTGTGAAAATCTAGATAATGG - Intronic
917499424 1:175572905-175572927 ACCTGGGAAATTCTAAATCATGG - Intronic
1064156663 10:12908495-12908517 GCCTGGGAAACACTAGGTCATGG + Intronic
1066826823 10:39606191-39606213 AATTGGGAAAAACTACTTTAAGG - Intergenic
1067696537 10:48539779-48539801 ACCAGAGAAAAACAACATGAAGG - Intronic
1069776588 10:70930806-70930828 ACCTCGCAAAAGCTACATGAAGG - Intergenic
1070084361 10:73221610-73221632 ACATGGGGAAAACTACATTAAGG - Intronic
1070250237 10:74766895-74766917 ACCTGGGAACACCCACACCAGGG + Intergenic
1072292632 10:93978385-93978407 ATCTTGGAAAAACTACTTCCTGG + Intergenic
1073976648 10:109109322-109109344 TCCTGGGAAAAAGTAGAGCAGGG + Intergenic
1074075241 10:110117321-110117343 ACCTGGAAAAAAAAACAACAGGG - Exonic
1076058547 10:127395237-127395259 ACCTGGGAATTCCTAGATCAAGG + Intronic
1081589348 11:44410201-44410223 ATCAGAGAAAACCTACATCAAGG - Intergenic
1082043624 11:47707244-47707266 AAAAGGGAAATACTACATCAAGG + Intronic
1082140413 11:48602759-48602781 ACGTGAAAAATACTACATCAAGG - Intergenic
1082567605 11:54699860-54699882 ACGTGAAAAATACTACATCAAGG - Intergenic
1082836541 11:57654997-57655019 AACTGGGAGAAACTGCCTCAAGG + Intronic
1082934293 11:58640280-58640302 ACCTGGGAACAAGTGCTTCATGG + Intergenic
1085816205 11:79739795-79739817 AAATGTGAAAAAATACATCAGGG + Intergenic
1088050149 11:105503439-105503461 AACTGGGAAGTACAACATCAAGG + Intergenic
1091790954 12:3271881-3271903 ACCTGCCAAGAACTTCATCATGG - Intronic
1091832580 12:3560358-3560380 ACATGTGAATAACTCCATCACGG - Intronic
1093104242 12:15066382-15066404 ACCTGGGACAAAATACATGAGGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1098781438 12:74691696-74691718 GCCTAAGAAAAATTACATCAAGG + Intergenic
1099432128 12:82599907-82599929 ACCTGTATAAAATTACATCATGG - Intergenic
1100851248 12:98714002-98714024 TTCTGGGATAAAGTACATCATGG + Intronic
1105916097 13:24917777-24917799 AGCTGGGAAAAACAAGAGCATGG + Intronic
1112431242 13:99352174-99352196 AGCTGCTAAAAAATACATCAAGG - Intronic
1113268554 13:108646239-108646261 GCATGCTAAAAACTACATCATGG - Intronic
1120546579 14:85819592-85819614 ACCTGGGAGAAAATACATACTGG + Intergenic
1122806096 14:104258529-104258551 ACATAGAAAAAACTACACCAAGG + Intergenic
1125266316 15:37885422-37885444 AACTGGGAAAAATCACATGATGG - Intergenic
1125758851 15:42083778-42083800 GCCTGGGGAAGACCACATCATGG + Exonic
1126283269 15:46981216-46981238 ACCTGGGAAGTTCAACATCAAGG - Intergenic
1127018356 15:54715032-54715054 ACTTGTTAAAAACTACAACAAGG + Intergenic
1127841096 15:62832681-62832703 ACCAGGGCAACACGACATCAAGG - Intronic
1133914972 16:10101238-10101260 ACCTGGGAAAAAATAAAATAGGG - Intronic
1138737410 16:59266302-59266324 AAATGGGAAAAACCACATCAAGG + Intergenic
1138834291 16:60414593-60414615 AAGTGGGAAGAACTATATCAAGG - Intergenic
1139721727 16:68861555-68861577 ACCTGGGTCACACTACCTCAGGG - Intronic
1140559877 16:75966669-75966691 AGCTGGGCAAAACTAGATGATGG + Intergenic
1141298674 16:82793042-82793064 ATCTGTGAATAACTCCATCAGGG - Intronic
1141982573 16:87559609-87559631 AACAGGGTTAAACTACATCAGGG + Intergenic
1142523579 17:521909-521931 ACCTAGGAGAAACAACATCAAGG + Intronic
1143301857 17:5916307-5916329 TCCTGAGAAATAATACATCATGG + Intronic
1144695097 17:17298609-17298631 AACTGGGAAAAACAGCATGATGG - Intergenic
1145101592 17:20081761-20081783 ACCTGTGAAAAGTTACAGCACGG - Intronic
1145104388 17:20103246-20103268 GCCTGAGAAAAACTGAATCATGG + Intronic
1146785816 17:35720431-35720453 ACCTGGGAATAAATTCAGCATGG + Intronic
1146891553 17:36509568-36509590 ACTTGTGCAGAACTACATCAGGG - Intronic
1147783937 17:42964499-42964521 ACGTGGGACAAACGTCATCAAGG + Intronic
1148333873 17:46828656-46828678 ACCTGGGCAGAACTACATTCTGG - Intronic
1148984484 17:51609756-51609778 ACCTGGGAAATTTGACATCAGGG - Intergenic
1149127425 17:53252998-53253020 AACTGGGAATAGCTACATAAAGG - Intergenic
1151553828 17:74836754-74836776 ACCTGGGAGCAACTAAATCTGGG - Exonic
1153548331 18:6233801-6233823 AATTGGGAAAAACTACTTTAAGG + Intronic
1154166722 18:12020763-12020785 ACTTAGGAAAAATTACATAAAGG - Intronic
1155250138 18:23946253-23946275 ACCTGGGATCACCTCCATCAGGG + Exonic
1157456622 18:47836199-47836221 CCCTGGGAAATACTACTACAAGG - Exonic
1158832170 18:61291323-61291345 AACTGGGAAAGGCTACATAAAGG + Intergenic
1159673794 18:71256096-71256118 ACCTGGGAAGAATGACATCGTGG + Intergenic
1167462199 19:49631396-49631418 CCCTGGGAAAAAGTACAGCTCGG - Intergenic
1167521807 19:49959871-49959893 ACCTGGAAAAAACTCCCTCAGGG + Intronic
1167523576 19:49970851-49970873 ACCTGGAAAAAACTCCCTCAGGG - Intergenic
1167756489 19:51416408-51416430 ACCTGGAAAAAACTCCCTCAGGG + Intronic
926446659 2:12950929-12950951 AGCTGATAAAAACTACATCAAGG + Intergenic
930375061 2:50554548-50554570 AAGTGGGAAAATCTACATAAAGG + Intronic
930485349 2:52005119-52005141 ATCTGGGGAAAACTACAGGAAGG + Intergenic
931061327 2:58532773-58532795 ACCTGTGACAAACTGCCTCAGGG - Intergenic
932869888 2:75388374-75388396 ACCTGGACAATACTACCTCAGGG - Intergenic
933543401 2:83677861-83677883 GACATGGAAAAACTACATCAAGG - Intergenic
935242819 2:101193019-101193041 AGCTGGGGAAAAAAACATCAAGG - Intronic
935572878 2:104680115-104680137 ACTTAGTAAAAACTTCATCAAGG - Intergenic
936122032 2:109755355-109755377 ACTTGGTAACAACTACATGAAGG + Intergenic
936222662 2:110616119-110616141 ACTTGGTAACAACTACATGAAGG - Intergenic
937377975 2:121350794-121350816 ACCTGGAAGAAAGTGCATCAAGG + Intronic
937542953 2:122981704-122981726 ACCTGGCAAATACTCCCTCAAGG + Intergenic
941173494 2:162168744-162168766 ACCTGGGAAATTCTACCTGAGGG + Intergenic
941909537 2:170750040-170750062 ACTTGGAAGAAACTACATCAAGG + Intergenic
942478588 2:176357386-176357408 ACATGCCAACAACTACATCAAGG - Intergenic
942862266 2:180629190-180629212 ACCTGGAAAATACTCCCTCATGG + Intergenic
945973954 2:216256507-216256529 ACCAAAGAAAAACAACATCATGG + Intergenic
946591418 2:221252896-221252918 GACTGGGAAAAGCTACATAAGGG + Intergenic
947553032 2:231061184-231061206 ACCTGGTCAAAAATACATGATGG - Intronic
1169428615 20:5515693-5515715 AATTGGGAAAAACTACTTTAAGG - Intergenic
1170606306 20:17877492-17877514 ACCTGCGAAAACATTCATCAAGG - Intergenic
1172729433 20:37073259-37073281 ACCTGGAACAAAATGCATCAGGG + Intronic
1173761098 20:45561346-45561368 GCCTGGGAAAAACACCATCTGGG + Intronic
1183184944 22:36286372-36286394 ACCTGGGAAACACTTCAGGACGG + Intronic
1183888920 22:40909101-40909123 AACTGTGAAAAACAACAGCAAGG - Exonic
1184740097 22:46423046-46423068 ACCTGGGCAACAGGACATCAGGG + Intronic
949739251 3:7211497-7211519 ACCTGGTAAAAACCAGAGCAAGG - Intronic
951445925 3:22780459-22780481 ACCTGGGAAAAAATAAATTGAGG + Intergenic
952007389 3:28857700-28857722 CTCTGGGAAAAGCTACAACATGG - Intergenic
953810100 3:46104812-46104834 ACCTGAGTAGAACCACATCAGGG - Intergenic
959686121 3:109148530-109148552 ACCAGGCAAAAACCACTTCATGG - Intergenic
962783030 3:138739577-138739599 AGCTGGGAAGTACTAGATCAAGG - Intronic
966080739 3:175997035-175997057 AACTTGGAAAACATACATCAAGG + Intergenic
969363910 4:6682894-6682916 ACCTGGGAAACACTTAATCGTGG + Intergenic
971598598 4:28564346-28564368 ACTTGGGAAAAACTACACATAGG + Intergenic
975168940 4:71211434-71211456 TCCTGGTAAAAACAACCTCATGG - Intronic
975539425 4:75490357-75490379 TGTTGGGAAAAACTACATAAAGG + Intronic
976424587 4:84887219-84887241 GGCTGGGGAAAAGTACATCAGGG + Intronic
977968936 4:103190277-103190299 AACTGGAAAAAACTACTTTAAGG + Intronic
979036438 4:115725526-115725548 ACCTGGGCAAAACCAAATCTTGG + Intergenic
980117320 4:128691963-128691985 AAATGGGAAAAACTTAATCAAGG + Intergenic
982974500 4:162036917-162036939 AAGTGGGAAAAATTACATGATGG + Intronic
985839143 5:2292606-2292628 ACCTGGCAAAGACTTCATGACGG + Intergenic
986751897 5:10794873-10794895 AGCTGGGGAAGACTACATGAGGG + Intergenic
989183699 5:38602882-38602904 ACCTGGGAAAAACAACTTCCTGG + Intronic
989317242 5:40095844-40095866 ACCTGGGAATAAATACAAGAAGG + Intergenic
989529826 5:42495022-42495044 ACCTGTGAAATAATACAACATGG - Intronic
992684503 5:79186305-79186327 ACCTAGGAACATCTACATCCTGG - Intronic
996817344 5:127588743-127588765 ACTTAGGAAAAACTAAGTCAGGG + Intergenic
997670807 5:135670408-135670430 GCCTGGAAAAGACTACAGCAGGG - Intergenic
998599604 5:143571660-143571682 AGCTGGGAAAAGCTAAAGCAGGG - Intergenic
999607299 5:153330054-153330076 ACCTGAGAAAAACAACAACGGGG + Intergenic
1000087403 5:157900074-157900096 ACCTGGGAGAAACTCCAGCCTGG - Intergenic
1000999914 5:167995865-167995887 ACCTGGGAAACAAGCCATCAGGG + Intronic
1001835502 5:174827939-174827961 AGCTGGGAAAGTCTAAATCAAGG + Intergenic
1001920779 5:175597698-175597720 ACATGGCAAATACTACATGATGG + Intergenic
1002157614 5:177295245-177295267 CCCTGGGAAAAGCCTCATCACGG + Exonic
1003211454 6:4071650-4071672 AGCTGGGAAAAAGTATTTCAAGG - Intronic
1003351167 6:5318976-5318998 ACCTGGGAAGAAGTAACTCAAGG + Intronic
1004227192 6:13796819-13796841 ACCTGGGAAAAACTACATCAAGG - Intronic
1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG + Intergenic
1005962405 6:30703574-30703596 AGCTGGGAAAAATGACTTCAGGG - Intronic
1006505810 6:34487943-34487965 ACCTGGGAACAGCTTCTTCAGGG + Intronic
1006751161 6:36378268-36378290 ACCTGGAAAAAAATACATTTGGG + Intronic
1006837974 6:37010704-37010726 AGCTGTGAATCACTACATCAAGG - Intronic
1007374713 6:41448615-41448637 ACCTGAGGAAAAATAAATCAGGG - Intergenic
1008058755 6:46974424-46974446 ACCTGGAAACAACCACACCATGG + Intergenic
1008164510 6:48119656-48119678 GCATGGGAAAACCTGCATCAGGG + Intergenic
1010711488 6:79180466-79180488 AGCTGGGTAAAAAGACATCAGGG - Intergenic
1011066246 6:83329257-83329279 ACCTGGAAGAATATACATCAAGG - Intronic
1011733077 6:90285890-90285912 ACCTGGCAAAAACAAAAACAGGG + Intronic
1015024213 6:128513934-128513956 ACCTAAGAAAAATCACATCAAGG + Intronic
1017314344 6:153013062-153013084 ATCTGCGAAAAACTAAATAAAGG - Intronic
1018499544 6:164391368-164391390 CCCTGGGAAATCCTATATCAAGG + Intergenic
1018850710 6:167588521-167588543 GCCTGAGAAAAACTACACAATGG + Intergenic
1021798286 7:24279480-24279502 AGCTCAGAAAAACTCCATCAAGG - Intergenic
1022960579 7:35422553-35422575 ACCTGGGAAAGACTTCCACATGG + Intergenic
1024932044 7:54674207-54674229 ACCTGTGTGAAATTACATCAAGG + Intergenic
1026079275 7:67202889-67202911 CACTGGGGAAAACTACATGAAGG - Intronic
1028897553 7:96059421-96059443 AGCTGGGAACAGGTACATCAGGG + Intronic
1031120388 7:117715270-117715292 ACATGTGAAAAGCTACATGAAGG + Intronic
1032902405 7:136324290-136324312 TCCTGGCAAAAACCACCTCAGGG - Intergenic
1034005302 7:147465807-147465829 ACCAGGGAAGAACTGCACCAGGG - Intronic
1036471172 8:9054124-9054146 ACCATGGAAAAGCAACATCAGGG + Intronic
1038585577 8:28785909-28785931 ACCTTGTAAAAAATCCATCAAGG - Intronic
1039683808 8:39773999-39774021 TTCTGGGATAAACTGCATCAAGG - Intronic
1042043575 8:64622505-64622527 ACCAGGGAATAACTTCAGCAAGG + Intronic
1042400237 8:68336657-68336679 GCCTGGGAATAACAACATCCTGG + Intronic
1044084883 8:87932314-87932336 ACATGGGTAAAACAACACCAAGG + Intergenic
1044639489 8:94363503-94363525 ACCTGGGAAACATTTCCTCATGG + Intergenic
1045434157 8:102143449-102143471 ACCTGAGGAAAACTACACGATGG - Intergenic
1050217432 9:3342835-3342857 ATCTTGGAAAAACTACTGCAAGG + Intronic
1053631444 9:39944338-39944360 ACTTGGGAAAATCTACAGAACGG - Intergenic
1053774320 9:41519192-41519214 ACTTGGGAAAATCTACAGAACGG + Intergenic
1054212443 9:62306360-62306382 ACTTGGGAAAATCTACAGAACGG + Intergenic
1054312544 9:63542472-63542494 ACTTGGGAAAATCTACAGAACGG - Intergenic
1055046503 9:71931175-71931197 ATCTGGGAAAAATTACATCTGGG + Intronic
1055544522 9:77355330-77355352 ACGTGAAAGAAACTACATCAAGG - Intronic
1055582397 9:77720912-77720934 ACCTGGGAAAAACATCAGGAGGG + Exonic
1055860098 9:80739226-80739248 ACATGAGAAAAACTACACCAGGG + Intergenic
1056043589 9:82693376-82693398 ACCTAGGAAAAATTCAATCAAGG - Intergenic
1056453026 9:86734896-86734918 CCCTGGGAAAATTTACTTCAAGG - Intergenic
1056647125 9:88423401-88423423 AATTGGGAAATACTACATTATGG + Intronic
1057401086 9:94724271-94724293 CCCTGGGAAAATACACATCAAGG + Intergenic
1057750458 9:97788395-97788417 CCTCTGGAAAAACTACATCACGG + Intergenic
1057984887 9:99702967-99702989 AACTGAGAAACACTACACCAGGG + Intergenic
1058131798 9:101262082-101262104 AACTGAGAAAAACTATACCAAGG + Intronic
1060843516 9:126815039-126815061 ACATGAAAAAAACTACAGCAAGG - Intronic
1060866746 9:127006278-127006300 CCCTGAGAAAAACAACGTCAAGG - Intronic
1061020640 9:128012200-128012222 ACATGTGACAACCTACATCAGGG + Intergenic
1185919882 X:4079065-4079087 ACCTGGGAAAGACACCATCATGG - Intergenic
1188074652 X:25760076-25760098 ACCTGTGGATAGCTACATCAGGG - Intergenic
1188774225 X:34193045-34193067 ACCTAGAAAAGACTACCTCAGGG - Intergenic
1188967643 X:36574678-36574700 ACCTGGGAAAAACTCTAACTAGG - Intergenic
1191655292 X:63590588-63590610 ACATAGGAAAACTTACATCATGG + Intergenic
1191958833 X:66677049-66677071 CCTAGGGAAAAACTACATCCTGG - Intergenic
1192337867 X:70237067-70237089 ACCTGAGCACAACTACCTCATGG + Exonic
1194183512 X:90742227-90742249 ACCTTGTAAAAAATAAATCAAGG + Intergenic
1197866379 X:131023046-131023068 AATTGTGAAAAACTACACCAAGG - Intergenic
1199029708 X:142982302-142982324 ACCTGGGAGAAAGTAGAACAGGG + Intergenic
1200530122 Y:4324172-4324194 ACCTTGTAAAAAATAAATCAAGG + Intergenic