ID: 1004230032

View in Genome Browser
Species Human (GRCh38)
Location 6:13824397-13824419
Sequence CAAAAATGAGAAAGGATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004230032_1004230037 12 Left 1004230032 6:13824397-13824419 CCTCAAATCCTTTCTCATTTTTG No data
Right 1004230037 6:13824432-13824454 TTGTTTTGCCTTCTGGACTGTGG No data
1004230032_1004230039 19 Left 1004230032 6:13824397-13824419 CCTCAAATCCTTTCTCATTTTTG No data
Right 1004230039 6:13824439-13824461 GCCTTCTGGACTGTGGCTGGAGG No data
1004230032_1004230041 20 Left 1004230032 6:13824397-13824419 CCTCAAATCCTTTCTCATTTTTG No data
Right 1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG No data
1004230032_1004230038 16 Left 1004230032 6:13824397-13824419 CCTCAAATCCTTTCTCATTTTTG No data
Right 1004230038 6:13824436-13824458 TTTGCCTTCTGGACTGTGGCTGG No data
1004230032_1004230034 5 Left 1004230032 6:13824397-13824419 CCTCAAATCCTTTCTCATTTTTG No data
Right 1004230034 6:13824425-13824447 GACCCATTTGTTTTGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004230032 Original CRISPR CAAAAATGAGAAAGGATTTG AGG (reversed) Intergenic
No off target data available for this crispr