ID: 1004230035

View in Genome Browser
Species Human (GRCh38)
Location 6:13824427-13824449
Sequence GTCCAGAAGGCAAAACAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004230035_1004230041 -10 Left 1004230035 6:13824427-13824449 CCCATTTGTTTTGCCTTCTGGAC No data
Right 1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004230035 Original CRISPR GTCCAGAAGGCAAAACAAAT GGG (reversed) Intergenic
No off target data available for this crispr