ID: 1004230041

View in Genome Browser
Species Human (GRCh38)
Location 6:13824440-13824462
Sequence CCTTCTGGACTGTGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004230032_1004230041 20 Left 1004230032 6:13824397-13824419 CCTCAAATCCTTTCTCATTTTTG No data
Right 1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG No data
1004230035_1004230041 -10 Left 1004230035 6:13824427-13824449 CCCATTTGTTTTGCCTTCTGGAC No data
Right 1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG No data
1004230033_1004230041 12 Left 1004230033 6:13824405-13824427 CCTTTCTCATTTTTGTGCAAGAC No data
Right 1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004230041 Original CRISPR CCTTCTGGACTGTGGCTGGA GGG Intergenic
No off target data available for this crispr