ID: 1004237492

View in Genome Browser
Species Human (GRCh38)
Location 6:13887302-13887324
Sequence CTACTTTACTAGGTAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004237492_1004237495 6 Left 1004237492 6:13887302-13887324 CCCACAGCTACCTAGTAAAGTAG No data
Right 1004237495 6:13887331-13887353 TTCTGTCTGTTTCATGTTTGAGG No data
1004237492_1004237496 15 Left 1004237492 6:13887302-13887324 CCCACAGCTACCTAGTAAAGTAG No data
Right 1004237496 6:13887340-13887362 TTTCATGTTTGAGGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004237492 Original CRISPR CTACTTTACTAGGTAGCTGT GGG (reversed) Intergenic
No off target data available for this crispr