ID: 1004246052

View in Genome Browser
Species Human (GRCh38)
Location 6:13977132-13977154
Sequence GACTCCGCAGTGTCTTCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004246052_1004246055 -3 Left 1004246052 6:13977132-13977154 CCTCCTGAAGACACTGCGGAGTC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1004246055 6:13977152-13977174 GTCTCAGGCCTCTGATGAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 1016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004246052 Original CRISPR GACTCCGCAGTGTCTTCAGG AGG (reversed) Exonic
900475240 1:2873391-2873413 GGAGCCGCAGGGTCTTCAGGAGG - Intergenic
900765873 1:4505068-4505090 GAGTCCTCAGGGACTTCAGGAGG - Intergenic
901911553 1:12462866-12462888 GGCTCCCCAGTGCCTTCATGAGG - Intronic
904343393 1:29852545-29852567 GTCTCTGGAGTGTCTTCATGGGG + Intergenic
905118162 1:35660350-35660372 GACTCTCCACTGTCTTCAAGAGG + Intergenic
918545906 1:185683660-185683682 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
923440834 1:234018638-234018660 GATTCAGCAGTGTGTTCATGAGG - Intronic
1071957815 10:90778431-90778453 GACTCTGCAGAGTCCCCAGGTGG - Intronic
1072986887 10:100148749-100148771 GACTCTTCAGTGGATTCAGGAGG - Intergenic
1076451032 10:130557114-130557136 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1076804440 10:132848095-132848117 GACTCTGCAGTGGCTGCACGTGG - Intronic
1080532626 11:33191892-33191914 GACTCCGCAGAGGCTGGAGGTGG + Intergenic
1082976758 11:59080380-59080402 GACACCGCAGGTCCTTCAGGGGG - Intergenic
1084093386 11:66894165-66894187 GACTCCCCACTGTCTGTAGGTGG + Intronic
1085233597 11:74993760-74993782 GACTCTGCAGAGTCTGGAGGTGG + Intronic
1086251255 11:84817311-84817333 GACTCCGCATCACCTTCAGGAGG - Intronic
1091442918 12:525625-525647 GACTCCGCCCTGACTTGAGGAGG - Intronic
1094744174 12:33324637-33324659 GACTCTGCAGAGTCTGGAGGCGG + Intergenic
1097097786 12:56563498-56563520 AACTCCGAAGGGTCTTCATGGGG - Intronic
1100529593 12:95451424-95451446 GATCCCGCAGGTTCTTCAGGGGG + Intergenic
1101232795 12:102758244-102758266 TACTCTGCAGTGTCTTCAAGGGG + Intergenic
1101883406 12:108641302-108641324 CCCTGAGCAGTGTCTTCAGGAGG - Intergenic
1103061858 12:117864645-117864667 CCTTCCGCAGTGCCTTCAGGGGG - Intronic
1104442169 12:128802568-128802590 GACACCAAAGTGTCTGCAGGGGG + Intronic
1104635968 12:130437991-130438013 GACCCAGCAGTATCTTAAGGCGG + Intronic
1104716406 12:131019148-131019170 GACTCAGCAGTGGCCTCTGGTGG + Intronic
1104795081 12:131511674-131511696 GACTTCCCAGAGTCTGCAGGTGG + Intergenic
1107911490 13:45109361-45109383 CACTCCAGAGTGTCTTAAGGTGG - Intergenic
1109444400 13:62414194-62414216 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1113285225 13:108839110-108839132 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1113671960 13:112181637-112181659 GACACTGCATTGTCTCCAGGTGG - Intergenic
1116855245 14:49946199-49946221 GACTCTGCAGTCACTTCAGGGGG - Intergenic
1121753118 14:96375815-96375837 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1124686358 15:31786112-31786134 GACTCTGCAGAGTCCCCAGGTGG - Intronic
1126970458 15:54105291-54105313 GTCTCAGCAGTGTTTTCAGATGG + Intronic
1130098991 15:80877665-80877687 GACCCAGCAGTGTCCTGAGGTGG - Intronic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1133291517 16:4725307-4725329 AACTCGGCACTGTCTTCAGAGGG + Intronic
1135204808 16:20474434-20474456 GACTCCGCAGAGTCCCAAGGAGG - Intronic
1137768525 16:50996297-50996319 GACTCCGCAGTTTCTGAATGTGG + Intergenic
1138154858 16:54693626-54693648 CATTGCCCAGTGTCTTCAGGTGG + Intergenic
1138893951 16:61180400-61180422 GCATCAGCAGTGTCTTCAAGAGG - Intergenic
1139334358 16:66220782-66220804 GGCTCCACAGTGTCTTCCAGAGG - Intergenic
1140036462 16:71375105-71375127 GCCTCCCTAGTGTCTTCAGCTGG - Intronic
1140421907 16:74826252-74826274 TAATCCTCAGTGTCTTCATGGGG - Intergenic
1140535840 16:75708688-75708710 AACTGAGCAGTCTCTTCAGGGGG + Intronic
1141448509 16:84080420-84080442 GACTTCTCAGTGTCTTGTGGGGG - Intronic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1145059202 17:19721532-19721554 CACTTGGCAGTGTCTTCTGGGGG - Intergenic
1147922412 17:43926115-43926137 GCCTTCACAGTCTCTTCAGGGGG - Intergenic
1148853040 17:50563945-50563967 GACTCCCCACAGGCTTCAGGAGG + Intronic
1151243366 17:72775427-72775449 GACTCCCCAGTGCCTCCAGGAGG - Intronic
1151286366 17:73114439-73114461 GACTCTGCAGAGTCTTGAAGTGG - Intergenic
1158191371 18:54832332-54832354 GTCTACCCAGTGTCTTCAGTAGG - Intronic
1162691228 19:12434024-12434046 GACTCTGCAGAGTCTCTAGGTGG - Intronic
1164683817 19:30153454-30153476 GACTCTGCAGAGCCTTCATGTGG + Intergenic
1164934594 19:32201117-32201139 CTCTCAGCAGAGTCTTCAGGTGG - Intergenic
1165406090 19:35632265-35632287 GGCTCCCCAGTGCCCTCAGGAGG + Intronic
1167825513 19:51969505-51969527 GACACCTCAGTATCCTCAGGAGG - Intronic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
927695450 2:25236698-25236720 GACTCCTCAGTGTCTACCGGGGG + Intronic
932201041 2:69829085-69829107 GACTCAAAAGTGCCTTCAGGAGG - Intergenic
933935112 2:87197362-87197384 GACTCCTCACTGTCTTCACATGG - Intergenic
936358032 2:111768536-111768558 GACTCCTCACTGTCTTCACATGG + Exonic
937285367 2:120747525-120747547 AACTGGGCAGTGTCTCCAGGGGG + Intronic
938679166 2:133671587-133671609 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
944538967 2:200738760-200738782 GACTCCTCAGGTGCTTCAGGAGG - Intergenic
947527505 2:230887817-230887839 GACTCAGCAGATCCTTCAGGAGG + Intergenic
1169249798 20:4051651-4051673 GACTCTGCAGAGTCTCCAGGTGG - Intergenic
1169395070 20:5221825-5221847 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1172764466 20:37343978-37344000 AAGTCGGCAGTGGCTTCAGGTGG + Intergenic
1177738228 21:25119697-25119719 GAAGCCTCAGTGTCTTCAGAGGG - Intergenic
1179524584 21:41967405-41967427 GGGTCAGCAGTGTCTTCAGCAGG - Intergenic
1179790732 21:43754616-43754638 GCGTCCGCAGTGGGTTCAGGTGG + Intronic
1179878279 21:44282451-44282473 GACTCGGCCCTGTCTTCAGTGGG - Intergenic
1180112839 21:45672202-45672224 GACTCTGCAGAGTCCTGAGGTGG - Intronic
1180793811 22:18592157-18592179 GACGCCGCAGGGACTCCAGGGGG - Intergenic
1180991032 22:19936328-19936350 GAATCCTCAGTATCGTCAGGTGG - Intronic
1181227929 22:21403163-21403185 GACGCCGCAGGGACTCCAGGGGG + Intergenic
1181250724 22:21531676-21531698 GACGCCGCAGGGACTCCAGGGGG - Intergenic
1181338873 22:22162890-22162912 GACATCTCAGTGTCATCAGGAGG - Intergenic
1181431556 22:22884752-22884774 GAGTCTGCAGTGCCTGCAGGTGG + Intronic
1184353710 22:43963849-43963871 GACCCCGCAGGGATTTCAGGTGG - Intronic
952327848 3:32336979-32337001 GACTCTGCAGAGTTTTGAGGCGG + Intronic
952413064 3:33066436-33066458 GACTCTGCAGAGTCCTGAGGGGG - Intronic
954446182 3:50547999-50548021 GTCTGGGCTGTGTCTTCAGGAGG + Intergenic
956757175 3:72400407-72400429 GACTCCCCACTGTCATCAGGTGG - Intronic
963344283 3:144075287-144075309 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
965474547 3:169139054-169139076 GACTCTACAGTGTTTTCAGTTGG - Intronic
970235317 4:13952801-13952823 GTCTCAGCATTGTCCTCAGGAGG - Intergenic
979018902 4:115469089-115469111 GACTCCGCAGAGTCCAGAGGTGG - Intergenic
979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG + Intronic
981361021 4:143845743-143845765 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981371759 4:143966745-143966767 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981823563 4:148914067-148914089 GACTCCGCTGTCTTGTCAGGGGG + Intergenic
985988865 5:3538869-3538891 CACTCCACAGTGTCATAAGGAGG + Intergenic
993656720 5:90586736-90586758 GATTCAGCAGTGGGTTCAGGTGG + Intronic
999617777 5:153443326-153443348 GACTCTGCAGAGTCCTGAGGAGG + Intergenic
1003613795 6:7636913-7636935 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1003863546 6:10343495-10343517 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1004246052 6:13977132-13977154 GACTCCGCAGTGTCTTCAGGAGG - Exonic
1005006469 6:21292275-21292297 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1007880813 6:45164562-45164584 GACTCACCAGTGTTTTAAGGTGG + Intronic
1009385375 6:63080203-63080225 GATCCCGCAGTTTCCTCAGGGGG + Intergenic
1014131526 6:117839867-117839889 GAGCCCACAGTGTCTACAGGGGG + Intergenic
1017484226 6:154888344-154888366 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1020376967 7:7498755-7498777 GCCACTGCAGTGTCTTCAGAGGG - Intronic
1022208307 7:28183727-28183749 GGATCCTCAGTGTCTTCAGTTGG - Intergenic
1024124008 7:46273177-46273199 GACTCTACAGAGTCTGCAGGAGG + Intergenic
1029805159 7:102988365-102988387 TACTCAGCAGTGTCTGGAGGTGG - Intronic
1032362979 7:131273250-131273272 GAATCCCCAGTGTCTTCATTAGG - Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033561543 7:142536714-142536736 GACTCTGCAGAGTCCCCAGGTGG + Intergenic
1038451028 8:27639051-27639073 GTGTCCTCAGTGTCTCCAGGTGG + Intronic
1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG + Intronic
1041153969 8:54964487-54964509 GACTCTGCAGAGTCCTCAGGTGG - Intergenic
1041356682 8:57007886-57007908 CACTCTGCAGAGTCTTGAGGGGG - Intergenic
1042867474 8:73368471-73368493 GACTCTGCAGTGTCCCCAGGTGG + Intergenic
1045518132 8:102879144-102879166 GACTCTGCAGTGTCCTGAGGTGG - Intronic
1049010348 8:139883224-139883246 GACTCTGCAGAGTGCTCAGGTGG - Intronic
1049092629 8:140527984-140528006 GACACCGGAGTGTCCCCAGGAGG - Intergenic
1056783803 9:89573482-89573504 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1058562973 9:106249359-106249381 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1062031524 9:134364160-134364182 GAGTGGGAAGTGTCTTCAGGCGG - Intronic
1062213153 9:135375353-135375375 GTCTCTGCTGTGTCTTCACGTGG - Intergenic
1062618630 9:137409249-137409271 GACTCCGAAGGGTCCTGAGGCGG - Intronic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1191698143 X:64010904-64010926 AACCCCACAGGGTCTTCAGGGGG - Intergenic
1196317891 X:114250745-114250767 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1196894370 X:120320604-120320626 GACTGCCCACTCTCTTCAGGCGG - Intergenic
1197717167 X:129718116-129718138 GAATCGGCAGTGTCCTCAGTTGG + Intergenic
1200466828 Y:3529418-3529440 GCCTCTACAGTGTTTTCAGGTGG + Intergenic