ID: 1004246327

View in Genome Browser
Species Human (GRCh38)
Location 6:13980152-13980174
Sequence ATGGGTTAGGTCCCCTTTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004246327_1004246329 -8 Left 1004246327 6:13980152-13980174 CCAACAAAGGGGACCTAACCCAT 0: 1
1: 0
2: 0
3: 10
4: 68
Right 1004246329 6:13980167-13980189 TAACCCATCACACTTTTAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004246327 Original CRISPR ATGGGTTAGGTCCCCTTTGT TGG (reversed) Exonic
901504954 1:9678958-9678980 ATGTGTAAGGCCCCTTTTGTGGG + Intronic
922825711 1:228516765-228516787 ATGGGTTTGGTCCCATTTATAGG - Intergenic
923591130 1:235320600-235320622 ATGTGTTAGGAACCCTTTGAAGG - Intronic
1070384116 10:75908577-75908599 ATGCATTGGGTCTCCTTTGTAGG + Intronic
1078185938 11:9052347-9052369 AAGGGTTTGGGCCCCTTTCTCGG + Intronic
1079644761 11:22849728-22849750 ATGGCTTAGCTCCCACTTGTAGG + Intronic
1089628573 11:119769344-119769366 ATGGGTTTGACCCACTTTGTAGG - Intergenic
1090550999 11:127819873-127819895 ATTGATTATGTCCCCTTTCTTGG - Intergenic
1110419835 13:75294180-75294202 ATGGTTTATGTCCCCTTTGGAGG - Intronic
1112028422 13:95434364-95434386 ATGGGTCAGCACCCCTATGTAGG + Intronic
1124015901 15:25875449-25875471 ACGTGTTAGGCCCCATTTGTGGG + Intergenic
1124098939 15:26675355-26675377 TTGGGTTAGGTCCTCTTGGAAGG - Intronic
1126517807 15:49555427-49555449 ATTGGTGAGGTTTCCTTTGTAGG + Intronic
1128142548 15:65312245-65312267 ATGGCTTAGATCACCTTTGTTGG + Intergenic
1135565157 16:23506311-23506333 ATGGGTTAAGTCAGATTTGTTGG - Intronic
1136352063 16:29717066-29717088 ATAGGTTAGGAACCCTGTGTGGG - Intergenic
1140239843 16:73191006-73191028 ATGGATTTGGTCCCATTTTTAGG - Intergenic
1143282778 17:5767080-5767102 TTGGGTTAGGGCCAGTTTGTGGG + Intergenic
1148236333 17:45971694-45971716 GTGGGGTTGGTCCCCTTTGTGGG + Intronic
1148410969 17:47467026-47467048 ATAAGACAGGTCCCCTTTGTTGG - Intergenic
1157572816 18:48724196-48724218 AGGATTTAGGTCCCCCTTGTAGG + Intronic
1157802495 18:50632176-50632198 TTGGGTTAGGTCCCCTGGGGCGG + Intronic
1158563370 18:58533855-58533877 AGGGGTTAGGACCCATTTGATGG + Intronic
1159914025 18:74173120-74173142 ATGGCTTAGAGCCCCTTTCTGGG - Intergenic
1166762271 19:45232355-45232377 CTGGGTTTGGTCCAATTTGTAGG - Intronic
925629610 2:5877335-5877357 ATGAGTTAGGTGGCATTTGTTGG - Intergenic
926249406 2:11145491-11145513 AAGGCTTAGTTCCTCTTTGTTGG + Exonic
927234876 2:20863168-20863190 ATGGGATAGATCCCATATGTAGG + Intergenic
934632074 2:95937582-95937604 ACAGTTTAGGACCCCTTTGTTGG - Intronic
936491363 2:112975330-112975352 ATGGCTTTGGTCCTCTTTGGGGG + Intronic
937303048 2:120854955-120854977 ATGGGGCAGGACCCCTTCGTGGG + Intronic
940486356 2:154300919-154300941 ATGTGTTAGGGCACCTTTATAGG - Intronic
945004217 2:205386336-205386358 ATGGGTTGGCTCCCCTGTGTGGG - Intronic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1173966790 20:47118517-47118539 ATGGGGGTGGTACCCTTTGTTGG + Intronic
1179358251 21:40682156-40682178 ATGGGGAAGGTTTCCTTTGTTGG + Intronic
1180988340 22:19918646-19918668 AAGGGTTTGCTCCCCTTTGCGGG - Intronic
951850534 3:27134503-27134525 GTGGGTTAAGTCCCCTTTGAAGG - Intronic
953534919 3:43770069-43770091 GTGGGCCATGTCCCCTTTGTGGG - Intergenic
953957885 3:47245600-47245622 ATGGGTGAGGCCCCTTGTGTGGG + Intronic
968957241 4:3725686-3725708 ATGGGTTAGGTGCCCATCGTGGG - Intergenic
972049960 4:34718335-34718357 ATGGGTTTGGTCCCCTGAATAGG - Intergenic
974946644 4:68536371-68536393 CTGGCTTCAGTCCCCTTTGTAGG + Intergenic
977955807 4:103024316-103024338 ATTGGTTAGGTGCACTTTGCTGG - Intronic
984240845 4:177217843-177217865 ATGGCTGAGGTCCCCATTCTAGG - Intergenic
1000600889 5:163273440-163273462 CTGGGTTGGGACCCCTTTCTTGG - Intergenic
1002282668 5:178141810-178141832 ATGGGTTAGGTTTCTTTTGGGGG - Intronic
1003950420 6:11110846-11110868 CTGAGTTAGCACCCCTTTGTGGG - Intronic
1004246327 6:13980152-13980174 ATGGGTTAGGTCCCCTTTGTTGG - Exonic
1013512969 6:110860239-110860261 ATGGGGTAGGGCCCCTGGGTGGG - Intronic
1020127445 7:5541007-5541029 ATGGGTGAGGCCCCCTTGGAGGG + Intronic
1022676446 7:32504043-32504065 ATGTGTTAGGCTCCCTTTGGTGG + Intronic
1024006471 7:45228111-45228133 AGGGGTGAGGTCCCCTGTGGAGG + Intergenic
1031358311 7:120816110-120816132 AGGAATTAGGTCCCCTTTCTTGG - Intronic
1032123462 7:129173612-129173634 TTGGGTTAGGTGCCTGTTGTGGG - Intergenic
1033040099 7:137909729-137909751 ATGGGTAAGGTCATCTTTTTTGG - Intronic
1034538245 7:151739249-151739271 ATGGGTCAGGTCCCCTAGGCAGG - Intronic
1038670850 8:29581714-29581736 ATGAGATAGTTCCCCTTGGTGGG - Intergenic
1040304837 8:46206659-46206681 ATGGGATAGGTCTCCTTGGGAGG - Intergenic
1040310292 8:46233389-46233411 ATGGGTGAGGTCGCCTTGGTAGG - Intergenic
1040333258 8:46403172-46403194 ATGGGAGAGGTCTCCTTTGGAGG - Intergenic
1041093466 8:54326298-54326320 TTGGGTTAGGACCCCCTTGTTGG + Intergenic
1043755243 8:83995222-83995244 ATGGGTTAGGATCCCTTTTGTGG - Intergenic
1046219608 8:111196660-111196682 CTGGGTTTGGCCCACTTTGTTGG + Intergenic
1047225469 8:122952570-122952592 ATGGGCTGCGTCACCTTTGTGGG - Exonic
1049154893 8:141060389-141060411 CTGGGTCAGGGCCCCTTTGTAGG - Intergenic
1049999586 9:1062772-1062794 ATGGGTAGGGTCCAATTTGTAGG + Intergenic
1053298770 9:36934004-36934026 AGGGCTTAGGTTCCCTCTGTGGG + Intronic
1053596742 9:39570117-39570139 ATGGGGAAGGTACCCTTGGTAGG + Intergenic
1053854712 9:42326764-42326786 ATGGGGAAGGTACCCTTGGTAGG + Intergenic
1054569512 9:66794885-66794907 ATGGGGAAGGTACCCTTGGTAGG - Intergenic
1058200204 9:102028925-102028947 ATGGATTTGGCCCCCTTTCTAGG + Intergenic
1187658637 X:21511952-21511974 ATGGGTTAGGTGCCCCTGTTGGG + Intronic
1193505150 X:82333581-82333603 AAGGATTAGGTCCCTTTTATAGG + Intergenic
1194235222 X:91374612-91374634 CCTGGTTAGGTTCCCTTTGTAGG - Intergenic
1196499869 X:116367313-116367335 ATGTGTTAGGTACTGTTTGTGGG + Intergenic
1197883907 X:131197811-131197833 ATGGCTATGGTCCCCTTTGGAGG - Intergenic
1199814771 X:151387618-151387640 ATGGCATTTGTCCCCTTTGTGGG - Intergenic