ID: 1004249013

View in Genome Browser
Species Human (GRCh38)
Location 6:14007082-14007104
Sequence GAGGAAGAAAGCGAATGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004249013_1004249018 26 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249013_1004249019 29 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249019 6:14007134-14007156 TCATGGCTCTCTTAGGATGGAGG No data
1004249013_1004249017 22 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249013_1004249020 30 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249020 6:14007135-14007157 CATGGCTCTCTTAGGATGGAGGG No data
1004249013_1004249016 12 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249016 6:14007117-14007139 TAACTGCTTATCAGAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004249013 Original CRISPR GAGGAAGAAAGCGAATGAAA TGG (reversed) Intergenic
No off target data available for this crispr