ID: 1004249014

View in Genome Browser
Species Human (GRCh38)
Location 6:14007101-14007123
Sequence GCAGTTATTACTTGGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004249014_1004249018 7 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249014_1004249016 -7 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249016 6:14007117-14007139 TAACTGCTTATCAGAATTCATGG No data
1004249014_1004249017 3 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249014_1004249019 10 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249019 6:14007134-14007156 TCATGGCTCTCTTAGGATGGAGG No data
1004249014_1004249020 11 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249020 6:14007135-14007157 CATGGCTCTCTTAGGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004249014 Original CRISPR GCAGTTATTACTTGGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr