ID: 1004249017

View in Genome Browser
Species Human (GRCh38)
Location 6:14007127-14007149
Sequence TCAGAATTCATGGCTCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004249008_1004249017 27 Left 1004249008 6:14007077-14007099 CCCCCCCATTTCATTCGCTTTCT No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249013_1004249017 22 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249009_1004249017 26 Left 1004249009 6:14007078-14007100 CCCCCCATTTCATTCGCTTTCTT No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249010_1004249017 25 Left 1004249010 6:14007079-14007101 CCCCCATTTCATTCGCTTTCTTC No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249014_1004249017 3 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249011_1004249017 24 Left 1004249011 6:14007080-14007102 CCCCATTTCATTCGCTTTCTTCC No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249012_1004249017 23 Left 1004249012 6:14007081-14007103 CCCATTTCATTCGCTTTCTTCCT No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data
1004249015_1004249017 -5 Left 1004249015 6:14007109-14007131 CCAAGTAATAACTGCTTATCAGA No data
Right 1004249017 6:14007127-14007149 TCAGAATTCATGGCTCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004249017 Original CRISPR TCAGAATTCATGGCTCTCTT AGG Intergenic
No off target data available for this crispr