ID: 1004249018

View in Genome Browser
Species Human (GRCh38)
Location 6:14007131-14007153
Sequence AATTCATGGCTCTCTTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004249013_1004249018 26 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249012_1004249018 27 Left 1004249012 6:14007081-14007103 CCCATTTCATTCGCTTTCTTCCT No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249014_1004249018 7 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249010_1004249018 29 Left 1004249010 6:14007079-14007101 CCCCCATTTCATTCGCTTTCTTC No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249009_1004249018 30 Left 1004249009 6:14007078-14007100 CCCCCCATTTCATTCGCTTTCTT No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249011_1004249018 28 Left 1004249011 6:14007080-14007102 CCCCATTTCATTCGCTTTCTTCC No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data
1004249015_1004249018 -1 Left 1004249015 6:14007109-14007131 CCAAGTAATAACTGCTTATCAGA No data
Right 1004249018 6:14007131-14007153 AATTCATGGCTCTCTTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004249018 Original CRISPR AATTCATGGCTCTCTTAGGA TGG Intergenic
No off target data available for this crispr