ID: 1004249019

View in Genome Browser
Species Human (GRCh38)
Location 6:14007134-14007156
Sequence TCATGGCTCTCTTAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004249015_1004249019 2 Left 1004249015 6:14007109-14007131 CCAAGTAATAACTGCTTATCAGA No data
Right 1004249019 6:14007134-14007156 TCATGGCTCTCTTAGGATGGAGG No data
1004249013_1004249019 29 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249019 6:14007134-14007156 TCATGGCTCTCTTAGGATGGAGG No data
1004249014_1004249019 10 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249019 6:14007134-14007156 TCATGGCTCTCTTAGGATGGAGG No data
1004249012_1004249019 30 Left 1004249012 6:14007081-14007103 CCCATTTCATTCGCTTTCTTCCT No data
Right 1004249019 6:14007134-14007156 TCATGGCTCTCTTAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004249019 Original CRISPR TCATGGCTCTCTTAGGATGG AGG Intergenic
No off target data available for this crispr