ID: 1004249020

View in Genome Browser
Species Human (GRCh38)
Location 6:14007135-14007157
Sequence CATGGCTCTCTTAGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004249014_1004249020 11 Left 1004249014 6:14007101-14007123 CCTCTCTTCCAAGTAATAACTGC No data
Right 1004249020 6:14007135-14007157 CATGGCTCTCTTAGGATGGAGGG No data
1004249013_1004249020 30 Left 1004249013 6:14007082-14007104 CCATTTCATTCGCTTTCTTCCTC No data
Right 1004249020 6:14007135-14007157 CATGGCTCTCTTAGGATGGAGGG No data
1004249015_1004249020 3 Left 1004249015 6:14007109-14007131 CCAAGTAATAACTGCTTATCAGA No data
Right 1004249020 6:14007135-14007157 CATGGCTCTCTTAGGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004249020 Original CRISPR CATGGCTCTCTTAGGATGGA GGG Intergenic
No off target data available for this crispr