ID: 1004250306

View in Genome Browser
Species Human (GRCh38)
Location 6:14018133-14018155
Sequence GCCGGCCGGCCCGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004250304_1004250306 -9 Left 1004250304 6:14018119-14018141 CCGCACTCGGAGCGGCCGGCCGG No data
Right 1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG No data
1004250296_1004250306 17 Left 1004250296 6:14018093-14018115 CCGGGTGGGGGTGGGCTCGGCGG No data
Right 1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG No data
1004250303_1004250306 -8 Left 1004250303 6:14018118-14018140 CCCGCACTCGGAGCGGCCGGCCG 0: 37
1: 286
2: 473
3: 657
4: 569
Right 1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG No data
1004250302_1004250306 -7 Left 1004250302 6:14018117-14018139 CCCCGCACTCGGAGCGGCCGGCC 0: 36
1: 279
2: 516
3: 499
4: 490
Right 1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG No data
1004250291_1004250306 29 Left 1004250291 6:14018081-14018103 CCAGCACGAGTTCCGGGTGGGGG No data
Right 1004250306 6:14018133-14018155 GCCGGCCGGCCCGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004250306 Original CRISPR GCCGGCCGGCCCGCAAGCCC CGG Intergenic
No off target data available for this crispr