ID: 1004252710

View in Genome Browser
Species Human (GRCh38)
Location 6:14035027-14035049
Sequence GTCCAGGACCATTCTTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004252710_1004252712 -8 Left 1004252710 6:14035027-14035049 CCCTGCTAAGAATGGTCCTGGAC No data
Right 1004252712 6:14035042-14035064 TCCTGGACCCCCCACTTCACTGG No data
1004252710_1004252723 30 Left 1004252710 6:14035027-14035049 CCCTGCTAAGAATGGTCCTGGAC No data
Right 1004252723 6:14035080-14035102 TCGCTTGTCCTCATTTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004252710 Original CRISPR GTCCAGGACCATTCTTAGCA GGG (reversed) Intergenic
No off target data available for this crispr