ID: 1004253639

View in Genome Browser
Species Human (GRCh38)
Location 6:14043203-14043225
Sequence CAGGAGTCCCTGCATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004253633_1004253639 7 Left 1004253633 6:14043173-14043195 CCAGAAGGAAGGATACGGGAGGC No data
Right 1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004253639 Original CRISPR CAGGAGTCCCTGCATGAGGA TGG Intergenic
No off target data available for this crispr