ID: 1004254468

View in Genome Browser
Species Human (GRCh38)
Location 6:14050330-14050352
Sequence CAGCATAACTAGATGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004254468_1004254473 -1 Left 1004254468 6:14050330-14050352 CCTTGTGCCATCTAGTTATGCTG No data
Right 1004254473 6:14050352-14050374 GCGGGGAGCAGCGTTGTCTTTGG No data
1004254468_1004254475 1 Left 1004254468 6:14050330-14050352 CCTTGTGCCATCTAGTTATGCTG No data
Right 1004254475 6:14050354-14050376 GGGGAGCAGCGTTGTCTTTGGGG No data
1004254468_1004254474 0 Left 1004254468 6:14050330-14050352 CCTTGTGCCATCTAGTTATGCTG No data
Right 1004254474 6:14050353-14050375 CGGGGAGCAGCGTTGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004254468 Original CRISPR CAGCATAACTAGATGGCACA AGG (reversed) Intergenic
No off target data available for this crispr