ID: 1004254948

View in Genome Browser
Species Human (GRCh38)
Location 6:14054871-14054893
Sequence AGTGATATGCAGACAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004254948_1004254951 -10 Left 1004254948 6:14054871-14054893 CCCACCACTGTCTGCATATCACT No data
Right 1004254951 6:14054884-14054906 GCATATCACTCCCATTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004254948 Original CRISPR AGTGATATGCAGACAGTGGT GGG (reversed) Intergenic
No off target data available for this crispr