ID: 1004258132

View in Genome Browser
Species Human (GRCh38)
Location 6:14083872-14083894
Sequence GTGTGTCAGTGGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004258132_1004258134 -6 Left 1004258132 6:14083872-14083894 CCACTCTGCTTCCACTGACACAC No data
Right 1004258134 6:14083889-14083911 ACACACAGAAGCAGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004258132 Original CRISPR GTGTGTCAGTGGAAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr