ID: 1004258156

View in Genome Browser
Species Human (GRCh38)
Location 6:14084118-14084140
Sequence CCTCCCAGGCAGGAGCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004258156_1004258162 24 Left 1004258156 6:14084118-14084140 CCTTGAAGCTCCTGCCTGGGAGG No data
Right 1004258162 6:14084165-14084187 CATCCCCTACCATCATGTAGTGG No data
1004258156_1004258160 -5 Left 1004258156 6:14084118-14084140 CCTTGAAGCTCCTGCCTGGGAGG No data
Right 1004258160 6:14084136-14084158 GGAGGATTTCCACTGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004258156 Original CRISPR CCTCCCAGGCAGGAGCTTCA AGG (reversed) Intergenic
No off target data available for this crispr