ID: 1004260249

View in Genome Browser
Species Human (GRCh38)
Location 6:14101641-14101663
Sequence CTGGAGTCACCGATTAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004260249_1004260257 26 Left 1004260249 6:14101641-14101663 CCCTGTTTAATCGGTGACTCCAG No data
Right 1004260257 6:14101690-14101712 TGATCTTACCTGGGGACCCAAGG No data
1004260249_1004260255 17 Left 1004260249 6:14101641-14101663 CCCTGTTTAATCGGTGACTCCAG No data
Right 1004260255 6:14101681-14101703 CACTGAAGTTGATCTTACCTGGG No data
1004260249_1004260256 18 Left 1004260249 6:14101641-14101663 CCCTGTTTAATCGGTGACTCCAG No data
Right 1004260256 6:14101682-14101704 ACTGAAGTTGATCTTACCTGGGG No data
1004260249_1004260258 30 Left 1004260249 6:14101641-14101663 CCCTGTTTAATCGGTGACTCCAG No data
Right 1004260258 6:14101694-14101716 CTTACCTGGGGACCCAAGGAAGG No data
1004260249_1004260254 16 Left 1004260249 6:14101641-14101663 CCCTGTTTAATCGGTGACTCCAG No data
Right 1004260254 6:14101680-14101702 CCACTGAAGTTGATCTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004260249 Original CRISPR CTGGAGTCACCGATTAAACA GGG (reversed) Intergenic
No off target data available for this crispr