ID: 1004260363

View in Genome Browser
Species Human (GRCh38)
Location 6:14102451-14102473
Sequence GGGTTCCAAGGTTGATGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004260354_1004260363 5 Left 1004260354 6:14102423-14102445 CCCACCACCAGCTCTTACTCTCA No data
Right 1004260363 6:14102451-14102473 GGGTTCCAAGGTTGATGGACAGG No data
1004260353_1004260363 27 Left 1004260353 6:14102401-14102423 CCTTGTGAAGGAGAGGCAATGTC No data
Right 1004260363 6:14102451-14102473 GGGTTCCAAGGTTGATGGACAGG No data
1004260357_1004260363 1 Left 1004260357 6:14102427-14102449 CCACCAGCTCTTACTCTCAGGAC No data
Right 1004260363 6:14102451-14102473 GGGTTCCAAGGTTGATGGACAGG No data
1004260358_1004260363 -2 Left 1004260358 6:14102430-14102452 CCAGCTCTTACTCTCAGGACTGG No data
Right 1004260363 6:14102451-14102473 GGGTTCCAAGGTTGATGGACAGG No data
1004260355_1004260363 4 Left 1004260355 6:14102424-14102446 CCACCACCAGCTCTTACTCTCAG No data
Right 1004260363 6:14102451-14102473 GGGTTCCAAGGTTGATGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004260363 Original CRISPR GGGTTCCAAGGTTGATGGAC AGG Intergenic