ID: 1004260988

View in Genome Browser
Species Human (GRCh38)
Location 6:14107645-14107667
Sequence TACATGCCCAATGCTATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004260986_1004260988 28 Left 1004260986 6:14107594-14107616 CCTCTGTCTTCATTGATACATTA No data
Right 1004260988 6:14107645-14107667 TACATGCCCAATGCTATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004260988 Original CRISPR TACATGCCCAATGCTATTCT TGG Intergenic