ID: 1004266679

View in Genome Browser
Species Human (GRCh38)
Location 6:14154119-14154141
Sequence GGGCCTGATGGACAATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004266679_1004266685 11 Left 1004266679 6:14154119-14154141 CCTGCTTATTGTCCATCAGGCCC No data
Right 1004266685 6:14154153-14154175 TCTCCCTACCTGACGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004266679 Original CRISPR GGGCCTGATGGACAATAAGC AGG (reversed) Intergenic
No off target data available for this crispr