ID: 1004271476

View in Genome Browser
Species Human (GRCh38)
Location 6:14199948-14199970
Sequence GATCTAGGAGTGGCTCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004271476_1004271482 20 Left 1004271476 6:14199948-14199970 CCTAGAGGAGCCACTCCTAGATC No data
Right 1004271482 6:14199991-14200013 CATTTCCAACTCTTTAAAGTTGG No data
1004271476_1004271484 29 Left 1004271476 6:14199948-14199970 CCTAGAGGAGCCACTCCTAGATC No data
Right 1004271484 6:14200000-14200022 CTCTTTAAAGTTGGTAATGTTGG No data
1004271476_1004271485 30 Left 1004271476 6:14199948-14199970 CCTAGAGGAGCCACTCCTAGATC No data
Right 1004271485 6:14200001-14200023 TCTTTAAAGTTGGTAATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004271476 Original CRISPR GATCTAGGAGTGGCTCCTCT AGG (reversed) Intergenic
No off target data available for this crispr