ID: 1004276144

View in Genome Browser
Species Human (GRCh38)
Location 6:14236629-14236651
Sequence GGTCAGAGCAGGAAACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004276135_1004276144 22 Left 1004276135 6:14236584-14236606 CCGCACCACTGACATTTAAATCA No data
Right 1004276144 6:14236629-14236651 GGTCAGAGCAGGAAACAAGCAGG No data
1004276136_1004276144 17 Left 1004276136 6:14236589-14236611 CCACTGACATTTAAATCAACGTT No data
Right 1004276144 6:14236629-14236651 GGTCAGAGCAGGAAACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004276144 Original CRISPR GGTCAGAGCAGGAAACAAGC AGG Intergenic
No off target data available for this crispr