ID: 1004277131

View in Genome Browser
Species Human (GRCh38)
Location 6:14247082-14247104
Sequence ACCTGTTAGGGCACACGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004277126_1004277131 7 Left 1004277126 6:14247052-14247074 CCAGAGTCAGCAAAGTTGCCCAA No data
Right 1004277131 6:14247082-14247104 ACCTGTTAGGGCACACGTGATGG No data
1004277125_1004277131 23 Left 1004277125 6:14247036-14247058 CCAGCTTTGTGCTGTGCCAGAGT No data
Right 1004277131 6:14247082-14247104 ACCTGTTAGGGCACACGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004277131 Original CRISPR ACCTGTTAGGGCACACGTGA TGG Intergenic
No off target data available for this crispr