ID: 1004278479

View in Genome Browser
Species Human (GRCh38)
Location 6:14258827-14258849
Sequence ACAGGGAGGCAGAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004278470_1004278479 30 Left 1004278470 6:14258774-14258796 CCGGTGGGTATTTGGTAGAAGGA No data
Right 1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004278479 Original CRISPR ACAGGGAGGCAGAGAGGGGA GGG Intergenic
No off target data available for this crispr