ID: 1004279870

View in Genome Browser
Species Human (GRCh38)
Location 6:14271473-14271495
Sequence CAGGAAGACCAGCTGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004279870_1004279881 19 Left 1004279870 6:14271473-14271495 CCCCTCTGCAGCTGGTCTTCCTG No data
Right 1004279881 6:14271515-14271537 AATTTGGAACTAGGGCTTTTGGG No data
1004279870_1004279880 18 Left 1004279870 6:14271473-14271495 CCCCTCTGCAGCTGGTCTTCCTG No data
Right 1004279880 6:14271514-14271536 AAATTTGGAACTAGGGCTTTTGG No data
1004279870_1004279877 10 Left 1004279870 6:14271473-14271495 CCCCTCTGCAGCTGGTCTTCCTG No data
Right 1004279877 6:14271506-14271528 TGCCTGGTAAATTTGGAACTAGG No data
1004279870_1004279873 -6 Left 1004279870 6:14271473-14271495 CCCCTCTGCAGCTGGTCTTCCTG No data
Right 1004279873 6:14271490-14271512 TTCCTGCTGCTCTCCTTGCCTGG No data
1004279870_1004279878 11 Left 1004279870 6:14271473-14271495 CCCCTCTGCAGCTGGTCTTCCTG No data
Right 1004279878 6:14271507-14271529 GCCTGGTAAATTTGGAACTAGGG No data
1004279870_1004279875 3 Left 1004279870 6:14271473-14271495 CCCCTCTGCAGCTGGTCTTCCTG No data
Right 1004279875 6:14271499-14271521 CTCTCCTTGCCTGGTAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004279870 Original CRISPR CAGGAAGACCAGCTGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr