ID: 1004280531

View in Genome Browser
Species Human (GRCh38)
Location 6:14276073-14276095
Sequence TGTCTCCGGGAGCTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280531_1004280539 19 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280539 6:14276115-14276137 TTTAATCCATCTACGGGACGAGG No data
1004280531_1004280542 27 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280542 6:14276123-14276145 ATCTACGGGACGAGGAAGCTGGG No data
1004280531_1004280541 26 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280541 6:14276122-14276144 CATCTACGGGACGAGGAAGCTGG No data
1004280531_1004280537 12 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280537 6:14276108-14276130 CCTTGGATTTAATCCATCTACGG No data
1004280531_1004280538 13 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280538 6:14276109-14276131 CTTGGATTTAATCCATCTACGGG No data
1004280531_1004280535 -5 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280535 6:14276091-14276113 AGACACTTTAGAACATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280531 Original CRISPR TGTCTCCGGGAGCTCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr