ID: 1004280535

View in Genome Browser
Species Human (GRCh38)
Location 6:14276091-14276113
Sequence AGACACTTTAGAACATGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280524_1004280535 27 Left 1004280524 6:14276041-14276063 CCATTTGCCACAGTGGGCACCTG No data
Right 1004280535 6:14276091-14276113 AGACACTTTAGAACATGCCTTGG No data
1004280529_1004280535 8 Left 1004280529 6:14276060-14276082 CCTGGAGCTTGATCCCACAGGGA No data
Right 1004280535 6:14276091-14276113 AGACACTTTAGAACATGCCTTGG No data
1004280532_1004280535 -6 Left 1004280532 6:14276074-14276096 CCACAGGGAGCTCCCGGAGACAC No data
Right 1004280535 6:14276091-14276113 AGACACTTTAGAACATGCCTTGG No data
1004280526_1004280535 20 Left 1004280526 6:14276048-14276070 CCACAGTGGGCACCTGGAGCTTG No data
Right 1004280535 6:14276091-14276113 AGACACTTTAGAACATGCCTTGG No data
1004280531_1004280535 -5 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280535 6:14276091-14276113 AGACACTTTAGAACATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280535 Original CRISPR AGACACTTTAGAACATGCCT TGG Intergenic
No off target data available for this crispr