ID: 1004280538

View in Genome Browser
Species Human (GRCh38)
Location 6:14276109-14276131
Sequence CTTGGATTTAATCCATCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280534_1004280538 -1 Left 1004280534 6:14276087-14276109 CCGGAGACACTTTAGAACATGCC No data
Right 1004280538 6:14276109-14276131 CTTGGATTTAATCCATCTACGGG No data
1004280533_1004280538 0 Left 1004280533 6:14276086-14276108 CCCGGAGACACTTTAGAACATGC No data
Right 1004280538 6:14276109-14276131 CTTGGATTTAATCCATCTACGGG No data
1004280529_1004280538 26 Left 1004280529 6:14276060-14276082 CCTGGAGCTTGATCCCACAGGGA No data
Right 1004280538 6:14276109-14276131 CTTGGATTTAATCCATCTACGGG No data
1004280531_1004280538 13 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280538 6:14276109-14276131 CTTGGATTTAATCCATCTACGGG No data
1004280532_1004280538 12 Left 1004280532 6:14276074-14276096 CCACAGGGAGCTCCCGGAGACAC No data
Right 1004280538 6:14276109-14276131 CTTGGATTTAATCCATCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280538 Original CRISPR CTTGGATTTAATCCATCTAC GGG Intergenic
No off target data available for this crispr