ID: 1004280542

View in Genome Browser
Species Human (GRCh38)
Location 6:14276123-14276145
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280536_1004280542 -8 Left 1004280536 6:14276108-14276130 CCTTGGATTTAATCCATCTACGG No data
Right 1004280542 6:14276123-14276145 ATCTACGGGACGAGGAAGCTGGG No data
1004280532_1004280542 26 Left 1004280532 6:14276074-14276096 CCACAGGGAGCTCCCGGAGACAC No data
Right 1004280542 6:14276123-14276145 ATCTACGGGACGAGGAAGCTGGG No data
1004280534_1004280542 13 Left 1004280534 6:14276087-14276109 CCGGAGACACTTTAGAACATGCC No data
Right 1004280542 6:14276123-14276145 ATCTACGGGACGAGGAAGCTGGG No data
1004280533_1004280542 14 Left 1004280533 6:14276086-14276108 CCCGGAGACACTTTAGAACATGC No data
Right 1004280542 6:14276123-14276145 ATCTACGGGACGAGGAAGCTGGG No data
1004280531_1004280542 27 Left 1004280531 6:14276073-14276095 CCCACAGGGAGCTCCCGGAGACA No data
Right 1004280542 6:14276123-14276145 ATCTACGGGACGAGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280542 Original CRISPR ATCTACGGGACGAGGAAGCT GGG Intergenic
No off target data available for this crispr