ID: 1004280555

View in Genome Browser
Species Human (GRCh38)
Location 6:14276218-14276240
Sequence ACCTTCTAGGTCCACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280555_1004280558 -10 Left 1004280555 6:14276218-14276240 CCCTGCAGGTGGACCTAGAAGGT No data
Right 1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG No data
1004280555_1004280564 10 Left 1004280555 6:14276218-14276240 CCCTGCAGGTGGACCTAGAAGGT No data
Right 1004280564 6:14276251-14276273 AGGCAAAAAGCAGAATGCCAGGG No data
1004280555_1004280565 14 Left 1004280555 6:14276218-14276240 CCCTGCAGGTGGACCTAGAAGGT No data
Right 1004280565 6:14276255-14276277 AAAAAGCAGAATGCCAGGGTTGG No data
1004280555_1004280563 9 Left 1004280555 6:14276218-14276240 CCCTGCAGGTGGACCTAGAAGGT No data
Right 1004280563 6:14276250-14276272 CAGGCAAAAAGCAGAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280555 Original CRISPR ACCTTCTAGGTCCACCTGCA GGG (reversed) Intergenic