ID: 1004280558

View in Genome Browser
Species Human (GRCh38)
Location 6:14276231-14276253
Sequence CCTAGAAGGTTCCCCAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280555_1004280558 -10 Left 1004280555 6:14276218-14276240 CCCTGCAGGTGGACCTAGAAGGT No data
Right 1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG No data
1004280551_1004280558 6 Left 1004280551 6:14276202-14276224 CCTGGCACTCTGGATTCCCTGCA No data
Right 1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280558 Original CRISPR CCTAGAAGGTTCCCCAAACC AGG Intergenic
No off target data available for this crispr