ID: 1004280833

View in Genome Browser
Species Human (GRCh38)
Location 6:14278425-14278447
Sequence GGCTGGGTAGTGAGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004280833_1004280848 19 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280848 6:14278467-14278489 CGAAGAAGGGGAGGAGGAGATGG No data
1004280833_1004280843 5 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280843 6:14278453-14278475 TGGGCAGGTGAGTTCGAAGAAGG No data
1004280833_1004280845 7 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280845 6:14278455-14278477 GGCAGGTGAGTTCGAAGAAGGGG No data
1004280833_1004280847 13 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280847 6:14278461-14278483 TGAGTTCGAAGAAGGGGAGGAGG No data
1004280833_1004280851 28 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280851 6:14278476-14278498 GGAGGAGGAGATGGAGGGAGAGG No data
1004280833_1004280850 23 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280850 6:14278471-14278493 GAAGGGGAGGAGGAGATGGAGGG No data
1004280833_1004280844 6 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280844 6:14278454-14278476 GGGCAGGTGAGTTCGAAGAAGGG No data
1004280833_1004280846 10 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280846 6:14278458-14278480 AGGTGAGTTCGAAGAAGGGGAGG No data
1004280833_1004280837 -10 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280837 6:14278438-14278460 CTACCCAGCCCCTGGTGGGCAGG No data
1004280833_1004280849 22 Left 1004280833 6:14278425-14278447 CCTGTTTCACTCACTACCCAGCC No data
Right 1004280849 6:14278470-14278492 AGAAGGGGAGGAGGAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004280833 Original CRISPR GGCTGGGTAGTGAGTGAAAC AGG (reversed) Intergenic