ID: 1004281539

View in Genome Browser
Species Human (GRCh38)
Location 6:14283755-14283777
Sequence CCATCCACACTGCCCTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004281539_1004281546 4 Left 1004281539 6:14283755-14283777 CCCTTAGAGGGCAGTGTGGATGG No data
Right 1004281546 6:14283782-14283804 CCTTTCTGCCCATGGAGGTTTGG No data
1004281539_1004281544 -1 Left 1004281539 6:14283755-14283777 CCCTTAGAGGGCAGTGTGGATGG No data
Right 1004281544 6:14283777-14283799 GGTTTCCTTTCTGCCCATGGAGG No data
1004281539_1004281547 5 Left 1004281539 6:14283755-14283777 CCCTTAGAGGGCAGTGTGGATGG No data
Right 1004281547 6:14283783-14283805 CTTTCTGCCCATGGAGGTTTGGG No data
1004281539_1004281550 15 Left 1004281539 6:14283755-14283777 CCCTTAGAGGGCAGTGTGGATGG No data
Right 1004281550 6:14283793-14283815 ATGGAGGTTTGGGTTTATACTGG No data
1004281539_1004281543 -4 Left 1004281539 6:14283755-14283777 CCCTTAGAGGGCAGTGTGGATGG No data
Right 1004281543 6:14283774-14283796 ATGGGTTTCCTTTCTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004281539 Original CRISPR CCATCCACACTGCCCTCTAA GGG (reversed) Intergenic