ID: 1004281547

View in Genome Browser
Species Human (GRCh38)
Location 6:14283783-14283805
Sequence CTTTCTGCCCATGGAGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004281541_1004281547 4 Left 1004281541 6:14283756-14283778 CCTTAGAGGGCAGTGTGGATGGG No data
Right 1004281547 6:14283783-14283805 CTTTCTGCCCATGGAGGTTTGGG No data
1004281539_1004281547 5 Left 1004281539 6:14283755-14283777 CCCTTAGAGGGCAGTGTGGATGG No data
Right 1004281547 6:14283783-14283805 CTTTCTGCCCATGGAGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004281547 Original CRISPR CTTTCTGCCCATGGAGGTTT GGG Intergenic