ID: 1004283516

View in Genome Browser
Species Human (GRCh38)
Location 6:14300385-14300407
Sequence GGCCCGGTGGCCAGATTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004283503_1004283516 29 Left 1004283503 6:14300333-14300355 CCACACAGATGGGACGCGGCTTA 0: 92
1: 223
2: 245
3: 88
4: 69
Right 1004283516 6:14300385-14300407 GGCCCGGTGGCCAGATTTCCGGG No data
1004283510_1004283516 -2 Left 1004283510 6:14300364-14300386 CCCGGGCTGCGGGCATTCTTTGG No data
Right 1004283516 6:14300385-14300407 GGCCCGGTGGCCAGATTTCCGGG No data
1004283512_1004283516 -3 Left 1004283512 6:14300365-14300387 CCGGGCTGCGGGCATTCTTTGGC No data
Right 1004283516 6:14300385-14300407 GGCCCGGTGGCCAGATTTCCGGG No data
1004283502_1004283516 30 Left 1004283502 6:14300332-14300354 CCCACACAGATGGGACGCGGCTT 0: 79
1: 172
2: 292
3: 314
4: 132
Right 1004283516 6:14300385-14300407 GGCCCGGTGGCCAGATTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004283516 Original CRISPR GGCCCGGTGGCCAGATTTCC GGG Intergenic
No off target data available for this crispr