ID: 1004285571

View in Genome Browser
Species Human (GRCh38)
Location 6:14317802-14317824
Sequence ATGCATCAGGACCACGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004285568_1004285571 -6 Left 1004285568 6:14317785-14317807 CCGGGGGATTGGATGGCATGCAT No data
Right 1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG No data
1004285567_1004285571 -5 Left 1004285567 6:14317784-14317806 CCCGGGGGATTGGATGGCATGCA No data
Right 1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG No data
1004285560_1004285571 30 Left 1004285560 6:14317749-14317771 CCAGGCACTGCTTTGACACGGAG No data
Right 1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004285571 Original CRISPR ATGCATCAGGACCACGGTGT TGG Intergenic
No off target data available for this crispr