ID: 1004288528

View in Genome Browser
Species Human (GRCh38)
Location 6:14345609-14345631
Sequence TCCCATGGCCATAGAGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004288519_1004288528 3 Left 1004288519 6:14345583-14345605 CCACCATTGCCCAGCCAGATTGG No data
Right 1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG No data
1004288523_1004288528 0 Left 1004288523 6:14345586-14345608 CCATTGCCCAGCCAGATTGGGGA No data
Right 1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG No data
1004288518_1004288528 10 Left 1004288518 6:14345576-14345598 CCAGCTGCCACCATTGCCCAGCC No data
Right 1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG No data
1004288525_1004288528 -7 Left 1004288525 6:14345593-14345615 CCAGCCAGATTGGGGATCCCATG No data
Right 1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG No data
1004288524_1004288528 -6 Left 1004288524 6:14345592-14345614 CCCAGCCAGATTGGGGATCCCAT No data
Right 1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004288528 Original CRISPR TCCCATGGCCATAGAGCGCC TGG Intergenic
No off target data available for this crispr